Details for Patent: 10,597,657

Which drugs does patent 10,597,657 protect, and when does it expire?

Patent 10,597,657 protects REDEMPLO and is included in one NDA.

This patent has forty patent family members in twenty-seven countries.

Summary for Patent: 10,597,657

Title:	RNAi agents and compositions for inhibiting expression of apolipoprotein C-III (APOC3)
Abstract:	The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting Apolipoprotein C-III (also called APOC3, apoC-III, APOC-III, and APO C-III) gene expression, and compositions that include APOC3 RNAi agents. The APOC3 RNAi agents disclosed herein may be conjugated to targeting ligands, including ligands that include N-acetyl-galactosamine, to facilitate the delivery to cells, including to hepatocytes. Pharmaceutical compositions that include one or more APOC3 RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the APOC3 RNAi agents in vivo provides for inhibition of APOC3 gene expression, and can result in lower triglycerides and/or cholesterol levels in the subject. The APOC3 RNAi agents can be used in methods of treatment of APOC3-related diseases and disorders, including hypertriglyceridemia, cardiovascular disease, and other metabolic-related disorders and diseases.
Inventor(s):	Zhen Li, Rui Zhu, Tao Pei, Steven Kanner, So Wong
Assignee:	Arrowhead Pharmaceuticals Inc
Application Number:	US16/126,740
Patent Claim Types: see list of patent claims	Use; Composition;

US Patent 10,597,657: APOC3 GalNAc-siRNA Claims, Patent Scope and Competitive Landscape

US Patent 10,597,657 covers chemically modified, N-acetyl-galactosamine-conjugated RNAi agents designed to silence the apolipoprotein C-III gene, or APOC3. The core commercial concept is a liver-targeted, subcutaneously administered siRNA duplex containing one of three specified 21-nucleotide antisense sequences and a multivalent GalNAc ligand attached to the sense strand.

The strongest claims are composition claims directed to defined APOC3 siRNA sequences and NAG37-conjugated duplexes, particularly AD05251, AD05876, AD05769 and AD05169. The patent also includes broader claims covering sequence variants, modified nucleotides, duplex architecture, pharmaceutical compositions, treatment of cardiometabolic disease, and reduction of triglyceride, cholesterol and LDL levels.

The patent does not, based on the claims supplied, cover every APOC3 therapeutic. Its practical scope depends on whether a competing product uses one of the claimed antisense sequences, substantially identical sequence architecture, the claimed GalNAc targeting configuration, or a method that falls within the treatment claims.

What does US Patent 10,597,657 cover?

The patent has four principal claim groups:

Claim group	Claims	Subject matter
Core RNAi agents	1-20, 38-51	APOC3 siRNA duplexes with specified antisense sequences and GalNAc targeting
Pharmaceutical compositions	21-25	Compositions containing the RNAi agents, excipients, additional APOC3 agents or other therapeutics
Cellular and therapeutic methods	26-37	APOC3 knockdown, treatment of APOC3-related diseases and lipid lowering
Specifically defined duplexes	38-51	AD05251, AD05876, AD05769 and AD05169

Claim 1 establishes the principal combination. It requires:

1. An antisense strand containing either SEQ ID NO: 3 or SEQ ID NO: 5.
2. A partially complementary sense strand.
3. Modified nucleotides on the antisense strand, sense strand, or both.
4. A targeting group containing N-acetyl-galactosamine.
5. The targeting group linked to the sense strand.

The claim is therefore a combination claim. A competing product would generally need to satisfy both the sequence limitations and the GalNAc-conjugation limitation to fall within the literal scope of claim 1.

What APOC3 sequences are protected?

The patent identifies three modified antisense sequences and two principal unmodified sequence variants.

Sequence designation	Antisense sequence	Distinguishing element
SEQ ID NO: 2 / SEQ ID NO: 3	UCACUGAGAAUACUGUCCCUC	Modified version and corresponding unmodified sequence
SEQ ID NO: 4 / SEQ ID NO: 5	UCACUGAGAAUACUGUCCCGU	Modified version and corresponding unmodified sequence
SEQ ID NO: 6	UCACUGAGA A UACUGUCCCUC, as represented in the claim	Modified sequence variant with a sequence change in the central region

The disclosed modified antisense strands use 2'-O-methyl and 2'-fluoro nucleotides, with phosphorothioate linkages at specified positions. The sense strands use 2'-O-methyl, 2'-fluoro and inosine residues.

Claims 38-51 narrow the protection to individual sequence pairings:

Commercial designation	Antisense	Sense	Claim
AD05251	SEQ ID NO: 2	SEQ ID NO: 501	40, 49
AD05876	SEQ ID NO: 4	SEQ ID NO: 572	45, 50
AD05769	SEQ ID NO: 6	SEQ ID NO: 557	48, 51
AD05169	SEQ ID NO: 2	SEQ ID NO: 482	42, 49

AD05251 receives the narrowest express protection in claim 20. Claims 40 and 42 separately protect two fully specified NAG37-conjugated sense strands paired with the SEQ ID NO: 2 antisense strand.

What formulations are protected by US 10,597,657?

The patent protects a molecular conjugate rather than a conventional small-molecule formulation. The key formulation and delivery limitations are:

• Duplex siRNA structure.
• 21- to 30-nucleotide sense and antisense strands.
• Preferred 21- to 24-nucleotide strands.
• A 21-base-pair duplex with two blunt ends.
• 2'-O-methyl and 2'-fluoro nucleotides.
• Phosphorothioate linkages.
• Inverted abasic residues at one or both termini.
• A multivalent N-acetyl-galactosamine targeting group.
• Attachment of the targeting group to the 5' terminal end of the sense strand.
• A pharmaceutically acceptable excipient.

Claim 40 is particularly important because it combines the SEQ ID NO: 2 antisense strand with a specified NAG37 structure, inverted abasic residues and the modified sense strand of SEQ ID NO: 501. Claim 45 performs the same function for AD05876, while claim 48 does so for AD05769.

The claims do not require a particular buffer, vial configuration, concentration, stabilizer, injection device or manufacturing process. A product may therefore infringe the composition claims even if its commercial formulation differs in pH, excipient system, concentration or packaging.

How broad are the GalNAc targeting claims?

Claim 3 lists a large family of targeting structures, including NAG13, NAG18, NAG24 through NAG39 and corresponding variants designated with the suffix "s." The claim set therefore reaches beyond a single NAG37 configuration at the broader dependent-claim level.

The practical hierarchy is:

Scope level	Relevant claims	Breadth
Any GalNAc-containing targeting group	1, 5-6	Broad functional scope
Listed NAG structures	3-4	Intermediate structural scope
Sense-strand conjugation	5-6	Narrows attachment site
NAG37 with defined chemical structure	40, 42, 45, 48	Narrow, high-specificity scope
Fully defined duplexes	19-20, 49-51	Narrowest sequence-specific scope

The use of "comprises" generally leaves room for additional structural elements unless the claim language or specification imposes a closed limitation. The phrase "at least partially complementary" in claim 1 is also broader than a requirement for exact full-length complementarity. The dependent claims, however, materially narrow the risk analysis by requiring defined strand sequences and architectures.

What methods of treatment are protected?

Claims 26-37 extend the patent beyond the molecule itself. They cover:

• Introducing the composition into a cell.
• Administering the composition to a human.
• Treating APOC3-related disease.
• Treating cardiometabolic disease.
• Lowering triglycerides.
• Lowering cholesterol.
• Lowering LDL.

The disease list includes:

• Hypertriglyceridemia.
• Obesity.
• Hyperlipidemia.
• Abnormal lipid or cholesterol metabolism.
• Atherosclerosis.
• Cardiovascular disease.
• Coronary artery disease.
• Hypertriglyceridemia-induced pancreatitis.
• Metabolic syndrome.
• Type 2 diabetes.
• Familial chylomicronemia syndrome.
• Familial partial lipodystrophy.

Claims 32-34 add dosing and route limitations. The claimed dose range is approximately 0.05 mg/kg to 5.0 mg/kg, with administration in two or more doses and by subcutaneous injection.

These method claims may create risk even when a product developer disputes composition-claim coverage. Their enforceability would depend on the actual label, promotional conduct, clinical protocol and the product's use in the United States.

When does US Patent 10,597,657 lose exclusivity?

The patent issued on March 24, 2020. US utility patents generally expire 20 years after the earliest effective nonprovisional filing date, subject to patent-term adjustment, terminal disclaimers and any patent-term extension under 35 U.S.C. § 156.

The grant date alone does not establish the expiration date. The relevant dates are:

Event	Date or rule
Patent grant	March 24, 2020
Ordinary patent term	20 years from the applicable earliest nonprovisional filing date
Patent-term adjustment	May extend the ordinary term
Patent-term extension	Potentially available for regulatory review, subject to statutory limits
Terminal disclaimer	Could shorten the term if required during prosecution

A definitive expiration date requires the USPTO patent-term calculation and the complete priority and prosecution record. The patent's enforceable term cannot be reliably calculated from the claims alone. The patent should be reviewed together with continuations, divisionals and related family members because a continuation may carry overlapping claims with a later expiration date.

What is the Orange Book status of US 10,597,657?

US Patent 10,597,657 is not automatically an Orange Book patent merely because it covers a pharmaceutical composition. The FDA Orange Book lists patents submitted by an applicant for an approved drug product and accepted under the applicable listing requirements. A patent covering an investigational or unapproved APOC3 siRNA is not independently listed.

For an approved product, the relevant questions would be:

1. Whether the product sponsor submitted the patent to FDA.
2. Whether the patent claims the approved drug substance, formulation or method of use.
3. Whether FDA accepted the patent for Orange Book publication.
4. Whether an approved label corresponds to the claimed APOC3 indications.

The patent itself does not establish an Orange Book listing. Orange Book status must be checked against the approved product's FDA application and current FDA patent listing data. The Orange Book is also not the principal patent database for biologics or products regulated through a biologics license application. [FDA, 2024a; FDA, 2024b]

Are Paragraph IV challenges relevant?

A Paragraph IV certification is relevant only if a generic applicant files an abbreviated new drug application referencing an approved drug and certifies that an Orange Book-listed patent is invalid, unenforceable or not infringed.

For this patent, Paragraph IV risk depends on four conditions:

Condition	Relevance
An APOC3 GalNAc-siRNA product receives FDA approval	Creates a potential reference product
The patent is listed in the Orange Book	Enables a Paragraph IV certification against the listed patent
A generic pathway is available	Determines whether an ANDA can be filed
The proposed product reads on the claims	Determines infringement exposure

A conventional ANDA pathway is less straightforward for complex siRNA products than for ordinary small molecules. The FDA may require product-specific analytical, pharmacokinetic, pharmacodynamic or clinical evidence. A follow-on applicant could still challenge the patent through an ANDA, a 505(b)(2) application where appropriate, a declaratory judgment action, or post-grant review and inter partes review.

No Paragraph IV challenge, ANDA litigation or settlement can be established from the claims supplied. A patent number alone does not show that a Paragraph IV notice has been served.

Which companies are most relevant to the APOC3 competitive landscape?

The primary competitive field includes companies developing APOC3 antisense or RNAi products rather than only products that practice this patent.

Company	Approach	Representative program or product	Relationship to this patent
Alnylam Pharmaceuticals	GalNAc-conjugated siRNA	APOC3 RNAi programs, including earlier development candidates	Potentially aligned with the claimed chemistry and conjugation model
Ionis Pharmaceuticals	Antisense oligonucleotide	Olezarsen and related APOC3 programs	Different modality; generally outside literal siRNA composition claims
Akcea Therapeutics	Antisense commercialization and development	Olezarsen program	Competitive threat but not necessarily a direct claim overlap
Arrowhead Pharmaceuticals	Targeted RNAi	APOC3-directed RNAi development efforts	Potential sequence, conjugate or platform overlap depending on product design
Regeneron Pharmaceuticals	Lipid-focused biologics and cardiovascular development	Competitive cardiometabolic pipeline	Commercial competitor rather than necessarily a direct infringer
Academic and specialty developers	RNA and oligonucleotide platforms	APOC3 and triglyceride-lowering candidates	Risk depends on sequence and delivery architecture

Olezarsen is an antisense product rather than a GalNAc-siRNA duplex. Its use of APOC3 as the target does not by itself create infringement. Patent analysis must compare the actual molecular structure, sequence, chemical modifications and method of use.

How strong is the patent estate for an APOC3 GalNAc-siRNA product?

US Patent 10,597,657 has meaningful blocking potential where a competing product uses the claimed sequence families and GalNAc architecture. Its principal strengths are:

• Defined APOC3 antisense sequences.
• Multiple claim layers from broad combination claims to exact duplex claims.
• Coverage of both molecular composition and therapeutic use.
• Specific protection for NAG37 conjugates.
• Claims directed to clinically relevant subcutaneous administration and lipid-lowering outcomes.
• Protection of modified nucleotide and phosphorothioate configurations used in siRNA drug design.

Its limitations are equally important:

• The broadest claim requires both the APOC3 sequence concept and a GalNAc targeting group.
• A competitor may select a different antisense sequence.
• A competitor may use a different ligand, linker or conjugation position.
• The claims do not expressly cover every APOC3 RNAi agent.
• Broad functional claims may face written-description, enablement, anticipation or obviousness challenges.
• The exact legal scope depends on the prosecution history and any claim amendments or examiner arguments.

The narrow sequence-specific claims are easier to map but provide less coverage against a genuinely redesigned product. The broader claims provide more leverage but are more exposed to validity and claim-construction disputes.

What generic or follow-on entry risks exist?

A follow-on developer has several design-around options:

1. Use a different APOC3 target sequence.
2. Retain the sequence but change the ligand or targeting group.
3. Use a different ligand-to-strand attachment site.
4. Alter the sense-strand architecture.
5. Remove the claimed inverted abasic residues.
6. Change modification patterns while preserving silencing activity.
7. Develop an antisense product rather than an siRNA duplex.
8. Pursue a different administration or indication strategy.

The most difficult design-around is a product that uses the same antisense sequence, NAG37 structure and sense-strand architecture while merely changing excipients. Such changes would likely have limited value against the composition claims.

Manufacturing patents can create a separate barrier. Commercial siRNA production may involve protected methods for solid-phase synthesis, conjugation, purification, duplex annealing, impurity removal and analytical characterization. Freedom to operate therefore requires a portfolio-level review, not analysis of US 10,597,657 alone.

What litigation and licensing issues should be reviewed?

The patent claims supplied do not identify litigation, settlement agreements or licenses. Those issues require review of:

• USPTO assignment records.
• Patent Trial and Appeal Board proceedings.
• PACER and district-court dockets.
• International patent litigation.
• Alnylam, Ionis, Arrowhead and licensee SEC filings.
• Development and commercialization agreements.
• Patent family continuations and terminal disclaimers.

Licensing risk is potentially material because GalNAc-siRNA platforms have historically been commercialized through platform licenses, regional rights and collaboration agreements. A developer may have freedom to practice the chemistry but lack commercial rights under a separate platform or target-specific agreement.

Key Takeaways

• US Patent 10,597,657 targets APOC3 silencing by GalNAc-conjugated, chemically modified siRNA.
• Its strongest claims cover specific antisense sequences paired with defined sense strands and NAG37 conjugates.
• AD05251, AD05876, AD05769 and AD05169 are expressly identified duplexes.
• Claims cover composition, pharmaceutical formulation, treatment of APOC3-related disease and lipid lowering.
• Olezarsen and other antisense products are competitive but do not automatically fall within these siRNA claims.
• The patent's exact expiration date cannot be determined from the claims or grant date alone because patent-term adjustment, terminal disclaimers and family relationships may affect the term.
• Orange Book listing and Paragraph IV risk cannot be inferred from the patent number.
• The primary design-around strategies are a different APOC3 sequence, ligand, conjugation site or oligonucleotide modality.
• Patent strength is highest against a product reproducing the claimed sequence, NAG37 structure and sense-strand architecture.

FAQs

Does US 10,597,657 cover all APOC3 siRNA drugs?

No. The claims focus on specified APOC3 antisense sequences, complementary strands, chemical modifications and GalNAc targeting groups. An APOC3 siRNA using a materially different sequence or delivery ligand may fall outside the literal claims.

Does a GalNAc-siRNA product infringe if it uses the same APOC3 sequence but a different GalNAc ligand?

Not necessarily. Literal infringement would depend on the claim language and the structural relationship between the competing ligand and the claimed targeting groups. The doctrine of equivalents could remain relevant, but it would require a product-specific analysis.

Is US 10,597,657 a patent on olezarsen?

No. Olezarsen is an antisense oligonucleotide product. The patent claims supplied are directed to double-stranded RNAi agents with GalNAc targeting, not to an antisense-only APOC3 drug.

Can a generic company file a Paragraph IV challenge against this patent?

Only if the patent is listed for an approved reference product and the applicant uses an abbreviated pathway that permits a Paragraph IV certification. The patent number alone does not establish that those conditions exist.

Does the patent protect subcutaneous administration?

Yes. Claim 34 expressly recites subcutaneous injection, while claims 32 and 33 address dose range and repeated dosing. The broader composition claims do not depend on subcutaneous administration.

References

1. Food and Drug Administration. (2024a). Approved drug products with therapeutic equivalence evaluations. U.S. Department of Health and Human Services.

2. Food and Drug Administration. (2024b). Patent listing requirements and the Orange Book. U.S. Department of Health and Human Services.

3. United States Patent and Trademark Office. (2024a). Manual of Patent Examining Procedure, Chapter 2700: Patent term. U.S. Department of Commerce.

4. United States Patent and Trademark Office. (2024b). Patent 10,597,657: RNAi agents for inhibiting expression of apolipoprotein C3. U.S. Department of Commerce.

5. U.S. Congress. (1984). Drug Price Competition and Patent Term Restoration Act of 1984, Pub. L. No. 98-417, 98 Stat. 1585.

Drugs Protected by US Patent 10,597,657

Applicant	Tradename	Generic Name	Dosage	NDA	Approval Date	TE	Type	RLD	RS	Patent No.	Patent Expiration	Product	Substance	Delist Req.	Patented / Exclusive Use	Submissiondate
Arrowhead	REDEMPLO	plozasiran sodium	SOLUTION;SUBCUTANEOUS	219947-001	Nov 18, 2025		RX	Yes	Yes			Y	Y		USE TO REDUCE TRIGLYCERIDES IN ADULTS WITH FAMILIAL CHYLOMICRONEMIA SYNDROME (FCS)

International Family Members for US Patent 10,597,657

Country	Patent Number	Estimated Expiration	Supplementary Protection Certificate	SPC Country	SPC Expiration
Argentina	113014
Australia	2018329190
Australia	2025267315
Brazil	112020002413
Canada	3074303
Chile	2020000593
Chile	2024003470