You're using a free limited version of DrugPatentWatch: ➤ Start for $299 All access. No Commitment.

Last Updated: March 26, 2026

Claims for Patent: 10,597,657


✉ Email this page to a colleague

« Back to Dashboard


Summary for Patent: 10,597,657
Title:RNAi agents and compositions for inhibiting expression of apolipoprotein C-III (APOC3)
Abstract:The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting Apolipoprotein C-III (also called APOC3, apoC-III, APOC-III, and APO C-III) gene expression, and compositions that include APOC3 RNAi agents. The APOC3 RNAi agents disclosed herein may be conjugated to targeting ligands, including ligands that include N-acetyl-galactosamine, to facilitate the delivery to cells, including to hepatocytes. Pharmaceutical compositions that include one or more APOC3 RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the APOC3 RNAi agents in vivo provides for inhibition of APOC3 gene expression, and can result in lower triglycerides and/or cholesterol levels in the subject. The APOC3 RNAi agents can be used in methods of treatment of APOC3-related diseases and disorders, including hypertriglyceridemia, cardiovascular disease, and other metabolic-related disorders and diseases.
Inventor(s):Zhen Li, Rui Zhu, Tao Pei, Steven Kanner, So Wong
Assignee: Arrowhead Pharmaceuticals Inc
Application Number:US16/126,740
Patent Claims: 1. An RNAi agent for inhibiting expression of an APOC3 gene, comprising: (a) an antisense strand comprising the nucleotide sequence selected from the group consisting of (5′→3′): (SEQ ID NO: 3) (i) UCACUGAGAAUACUGUCCCUC; and (SEQ ID NO: 5) (ii) UCACUGAGAAUACUGUCCCGU; and (b) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides on the antisense strand, the sense strand, or both the antisense strand and the sense strand are modified nucleotides, and wherein the sense strand is linked to a targeting group that comprises N-acetyl-galactosamine.

2. The RNAi agent of claim 1, wherein the modified nucleotides are 2′-O methyl nucleotides, 2′-fluoro nucleotides, or combinations thereof.

3. The RNAi agent of claim 1, wherein the targeting group comprises a structure selected from the group consisting of: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

4. The RNAi agent of claim 3, wherein the targeting group comprises the structure of:

5. The RNAi agent of claim 3, wherein the targeting group is conjugated to the sense strand.

6. The RNAi agent of claim 5, wherein the targeting group is conjugated to the 5′ terminal end of the sense strand.

7. The RNAi agent of claim 1, wherein the sense strand is between 21 and 30 nucleotides in length, and the antisense strand is between 21 and 30 nucleotides in length.

8. The RNAi agent of claim 7, wherein the sense strand and the antisense strand are each between 21 and 27 nucleotides in length.

9. The RNAi agent of claim 8, wherein the sense strand and the antisense strand are each between 21 and 24 nucleotides in length.

10. The RNAi agent of claim 9, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

11. The RNAi agent of claim 10, wherein the RNAi agent has two blunt ends.

12. The RNAi agent of claim 1, wherein the sense strand comprises one or two terminal caps.

13. The RNAi agent of claim 1, wherein the sense strand comprises one or two inverted abasic residues.

14. The RNAi agent of claim 1, wherein the sense strand comprises the nucleotide sequence selected from the group consisting of (5′→3′): SEQ ID NO: 16) (GAGGGACAGUAUUCUCAGUIA; (SEQ ID NO: 18) (ACGGGACAGUAUUCUCAGUIA; and (SEQ ID NO: 21) (GAGGGACAGUAUUCUCAGUGA; wherein I represents an inosine nucleotide.

15. The RNAi agent of claim 14, wherein the sense strand further includes inverted abasic residues at the 3′ terminal end and at the 5′ end of the nucleotide sequence.

16. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequences selected from the group consisting of (5′→3′): (SEQ ID NO: 2) usCfsasCfuGfagaauAfcUfgUfcCfcUfsc; (SEQ ID NO: 4) usCfsasCfuGfagaauAfcUfgUfcCfcGfsu; and (SEQ ID NO: 6) usCfsascugagaauAfcUfgUfcCfcUfsc; wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; ands represents a phosphorothioate linkage.

17. The RNAi agent of claim 16, wherein the sense strand comprises the nucleotide sequence selected from the group consisting of (5′→3′): (SEQ ID NO: 15) gagggacaGfUfAfuucucaguia; (SEQ ID NO: 17) acgggacaGfUfAfuucucaguia; (SEQ ID NO: 19) gagggacaGfuAfuUfcucaguia; and (SEQ ID NO: 20) gagggacaGfUfAfuucucaguga; wherein a, c, g, i, and u represent 2′-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, If, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, inosine or uridine, respectively; and s represents a phosphorothioate linkage.

18. The RNAi agent of claim 17, wherein the sense strand further includes an inverted abasic residue at the 3′ terminal end and/or at the 5′ end of the nucleotide sequence.

19. The RNAi agent of claim 1, wherein the RNAi agent has the duplex structure selected from the group consisting of: AD05251 (SEQ ID NOs: 2 and 501); AD05876 (SEQ ID NOs: 4 and 572); AD05769 (SEQ ID NOs: 6 and 557); and AD05169 (SEQ ID NOs: 2 and 482).

20. The RNAi agent of claim 19, wherein the RNAi agent has the duplex structure of AD05251 (SEQ ID NOs: 2 and 501).

21. A composition comprising the RNAi agent of claim 1, wherein the composition comprises a pharmaceutically acceptable excipient.

22. A composition comprising the RNAi agent of claim 16, wherein the composition comprises a pharmaceutically acceptable excipient.

23. A composition comprising the RNAi agent of claim 17, wherein the composition comprises a pharmaceutically acceptable excipient.

24. The composition of claim 21, wherein the composition further comprises a second RNAi agent for inhibiting the expression of an APOC3 gene.

25. The composition of claim 21, wherein the composition further comprises one or more additional therapeutics.

26. A method for inhibiting expression of an APOC3 gene in a cell, the method comprising introducing into a cell an effective amount of the composition of claim 21.

27. The method of claim 26, wherein the cell is within a subject.

28. The method of claim 27, wherein the subject is a human subject.

29. A method of treating an APOC3-related disease or disorder, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of claim 21.

30. The method of claim 29, wherein the disease is a cardiometabolic disease.

31. The method of claim 30, wherein the cardiometabolic disease is hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and/or abnormal cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia induced pancreatitis, metabolic syndrome, type II diabetes mellitus, familial chylomicronernia syndrome, or familial partial lipodystrophy.

32. The method of claim 29, wherein the RNAi agent is administered at a dose of about 0.05 mg/kg to about 5.0 mg/kg of body weight of the human subject.

33. The method of claim 29, wherein the RNAi agent is administered in two or more doses.

34. The method of claim 29, wherein the dose is administered by subcutaneous injection.

35. A method of lowering triglyceride levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 21.

36. A method of lowering cholesterol levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 21.

37. A method of lowering low density lipoprotein (LDL) levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 21.

38. The RNAi agent of claim 16, wherein the antisense strand comprises the nucleotide sequence (5′→3′) usCfsasCfuGfagaauAfcUfgUfcCfcUfsc (SEQ ID NO:2); wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage.

39. The RNAi agent of claim 38, wherein the sense strand comprises the nucleotide sequence (5′→3′) gagggacaGfUfAfuucucaguia (SEQ ID NO:15), wherein a, c, g, i, and u represent 2′-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and wherein the sense strand optionally includes inverted abasic residues at the 3′ terminal end and/or at the 5′ end of the nucleotide sequence.

40. The RNAi agent of claim 38, wherein the sense strand comprises the nucleotide sequence (5′→3′) (NAG37)s(invAb)sgagggacaGfUfAfuucucaguias(invAb) (SEQ ID NO:501), wherein a, c, g, i, and u are 2′-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue, and (NAG37)s has the following chemical structure:

41. The RNAi agent of claim 38, wherein the sense strand comprises the nucleotide sequence (5′→3′) gagggacaGfUfAfuucucaguga (SEQ ID NO:20), wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and wherein the sense strand optionally includes inverted abasic residues at the 3′ terminal end and/or at the 5′ end of the nucleotide sequence.

42. The RNAi agent of claim 38, wherein the sense strand comprises the nucleotide sequence (5′→3′) (NAG37)s(invAb)sgagggacaGfUfAfuucucagugas(invAb) (SEQ ID NO:482), wherein a, c, g, i, and u are 2′-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue, and (NAG37)s has the following chemical structure:

43. The RNAi agent of claim 16, wherein the antisense strand comprises the nucleotide sequence (5′→3′) usCfsasCfuGfagaauAfcUfgUfcCfcGfsu (SEQ ID NO:4); wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage.

44. The RNAi agent of claim 43, wherein the sense strand comprises the nucleotide sequence (5′→3′) acgggacaGfUfAfuucucaguia (SEQ ID NO:17), wherein a, c, g, i, and u represent 2′-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and wherein the sense strand optionally includes inverted abasic residues at the 3′ terminal end and/or at the 5′ end of the nucleotide sequence.

45. The RNAi agent of claim 43, wherein the sense strand comprises the nucleotide sequence (5′→3′) (NAG37)s(invAb)sacgggacaGfUfAfuucucaguias(invAb) (SEQ ID NO:572), wherein a, c, g, i, and u are 2′-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue, and (NAG37)s has the following chemical structure:

46. The RNAi agent of claim 16, wherein the antisense strand comprises the nucleotide sequence (5′→3′) usCfsascugagaauAfcUfgUfcCfcUfsc (SEQ ID NO:6); wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage.

47. The RNAi agent of claim 46, wherein the sense strand comprises the nucleotide sequence (5′→3′) gagggacaGfuAfuUfcucaguia (SEQ ID NO:19), wherein a, c, g, i, and u represent 2′-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and wherein the sense strand optionally includes inverted abasic residues at the 3′ terminal end and/or at the 5′ end of the nucleotide sequence.

48. The RNAi agent of claim 46, wherein the sense strand comprises the nucleotide sequence (5′→3′) (NAG37)s(invAb)sgagggacaGfuAfuUfcucaguias(invAb) (SEQ ID NO:557), wherein a, c, g, i, and u are 2′-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue, and (NAG37)s has the following chemical structure:

49. The RNAi agent of claim 19, wherein the RNAi agent has the duplex structure of AD05169 (SEQ ID NOs: 2 and 482).

50. The RNAi agent of claim 19, wherein the RNAi agent has the duplex structure of AD05876 (SEQ ID NOs: 4 and 572).

51. The RNAi agent of claim 19, wherein the RNAi agent has the duplex structure of AD05769 (SEQ ID NOs: 6 and 557).

Make Better Decisions: Try a trial or see plans & pricing

Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. We do not provide individual investment advice. This service is not registered with any financial regulatory agency. The information we publish is educational only and based on our opinions plus our models. By using DrugPatentWatch you acknowledge that we do not provide personalized recommendations or advice. thinkBiotech performs no independent verification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.