United States Patent 9,447,415 is a composition patent directed to morpholino antisense oligonucleotides that induce skipping of exon 45 in human dystrophin pre-mRNA. Its core scope covers 20- to 31-base antisense molecules with at least 20 consecutive bases complementary to a defined exon 45 sequence, plus pharmaceutical compositions containing those molecules. The patent is commercially relevant to casimersen, marketed as Amondys 45, and is listed in the FDA Orange Book for the product. The nominal patent term extends into 2031, subject to any patent-term adjustment, terminal disclaimer, or other recorded modification.

United States Patent 9,447,415: Claim Scope, Exon 45 Antisense Coverage, and Casimersen Patent Landscape

What does United States Patent 9,447,415 protect?

US 9,447,415 protects a morpholino antisense oligonucleotide designed to bind exon 45 of human dystrophin pre-mRNA and cause exon 45 skipping.

The independent claims contain five material limitations:

Claim element	Scope
Molecule type	Antisense oligonucleotide
Length	20 to 31 bases
Sequence relationship	100% complementary to consecutive bases of exon 45 of human dystrophin pre-mRNA
Required sequence region	At least 20 consecutive bases corresponding to the disclosed SEQ ID NO: 207 region
Chemistry and function	Morpholino chemistry that induces exon 45 skipping

Claim 2 extends the protection to a pharmaceutical composition containing the claimed morpholino and a pharmaceutically acceptable carrier.

The claims are product claims rather than claims limited to a particular administration route, dose, treatment schedule, patient genotype, or clinical endpoint.

What sequence does the patent cover?

The claim identifies the following 26-base exon 45 sequence:

CCA AUG CCA UCC UGG AGU UCC UGU AA

The claim states that uracil bases are treated as thymine bases. In DNA-style notation, the sequence is:

CCATGCCATCCTGGAGTTCCTGTAA

The claimed antisense molecule must be 100% complementary to consecutive exon 45 bases and must contain at least 20 consecutive bases from the specified sequence region, subject to the claim's orientation and sequence construction.

The principal covered sequence space is therefore a family of overlapping 20- to 31-base morpholino oligomers. A 20-base oligomer can fall within the claim if it is fully complementary to a qualifying consecutive segment. Longer oligomers can qualify if they contain at least 20 consecutive bases from the specified target region and remain 100% complementary to consecutive exon 45 bases.

Claim construction points

The most important claim-construction issues are:

Whether "comprises at least 20 consecutive bases" permits additional flanking bases within the 20- to 31-base molecule.
Whether the sequence identified in SEQ ID NO: 207 is interpreted as the target exon sequence or as the antisense sequence itself.
Whether the 100% complementarity requirement applies to the entire oligonucleotide or only to the claimed consecutive target segment.
How "induces exon 45 skipping" is measured and whether a particular assay threshold is required.
Whether morpholino chemistry must be limited to a specific backbone, such as phosphorodiamidate morpholino oligomer chemistry.

The written claim language favors a broad overlapping-oligomer interpretation, but the patent specification and prosecution history would control any litigation dispute over orientation, flanking bases, and the meaning of the functional limitation.

How broad is claim 1 of US 9,447,415?

Claim 1 is narrow by therapeutic target but broad within the defined exon 45 sequence window.

It does not claim every exon 45-skipping antisense oligonucleotide. It requires all of the following:

A morpholino antisense oligonucleotide.
A length between 20 and 31 bases.
Complete complementarity to consecutive exon 45 bases.
At least 20 consecutive bases from the specified sequence region.
Demonstrated exon 45-skipping activity.

The claim does not expressly require:

A particular trade name or product designation.
A specific dose or concentration.
A particular formulation excipient.
Intravenous administration.
Treatment of Duchenne muscular dystrophy.
A specific mutation or deletion genotype.
A specific level of dystrophin restoration.
A particular manufacturing process.

That structure gives the patent meaningful blocking potential against closely related morpholino sequences targeting the same exon 45 region. It does not necessarily block exon 45-skipping compounds using a different target window, a different antisense chemistry, or a sequence with less than 20 qualifying consecutive bases.

What does claim 2 add to the patent protection?

Claim 2 covers a pharmaceutical composition containing:

The claimed exon 45-skipping morpholino; and
A pharmaceutically acceptable carrier.

The carrier limitation is conventional and does not materially narrow the commercial product category. A finished injectable drug product containing a covered morpholino and standard pharmaceutical excipients would generally fall within the conceptual scope of claim 2.

Claim 2 can be important in an infringement case because a marketed drug is ordinarily sold as a pharmaceutical composition rather than as an isolated oligonucleotide. It also provides a formulation-level claim even though it does not recite a detailed buffer, pH range, concentration, container, or administration device.

What drug is associated with US 9,447,415?

The patent is associated with casimersen, marketed in the United States as Amondys 45 by Sarepta Therapeutics, Inc.

Casimersen is an antisense oligonucleotide for patients with Duchenne muscular dystrophy whose dystrophin gene mutations are amenable to exon 45 skipping. The FDA approved Amondys 45 in February 2021 under the accelerated approval pathway based on an increase in dystrophin production in skeletal muscle. The approval requires confirmatory clinical evidence of clinical benefit. (U.S. Food and Drug Administration, 2021a)

Product	Active ingredient	Target exon	Sponsor	FDA approval
Amondys 45	Casimersen	45	Sarepta Therapeutics	February 25, 2021
Exondys 51	Eteplirsen	51	Sarepta Therapeutics	September 19, 2016
Vyondys 53	Golodirsen	53	Sarepta Therapeutics	December 12, 2019
Viltepso	Viltolarsen	53	NS Pharma	August 12, 2020

The product association does not mean that US 9,447,415 is the only patent relevant to casimersen. Commercial protection typically includes composition, formulation, manufacturing, use, and regulatory exclusivity rights.

What is the Orange Book status of US 9,447,415?

US 9,447,415 is listed in the FDA Orange Book for Amondys 45. The listing identifies the patent as a product-related patent for the approved casimersen product. The Orange Book listing places the patent in the standard Hatch-Waxman framework for a potential abbreviated new drug application.

The patent has a nominal expiration date in January 2031 based on the underlying patent term. The operative date should be confirmed against the current FDA Orange Book entry and the USPTO patent record because patent-term adjustment, terminal disclaimers, or regulatory extensions can affect the enforceable date. The FDA Orange Book does not itself determine infringement or validity. (U.S. Food and Drug Administration, 2025; United States Patent and Trademark Office, 2016)

Hatch-Waxman significance

A generic applicant seeking approval of a casimersen product would need to address the listed patent through one of the statutory certification pathways. A Paragraph IV certification would assert that the patent is invalid, unenforceable, or not infringed.

If the innovator sued within the statutory period after receiving a Paragraph IV notice, FDA approval could be subject to a 30-month stay, subject to the statutory exceptions and litigation outcome.

When does casimersen lose patent and regulatory exclusivity?

Protection	Date or period	Significance
FDA approval	February 25, 2021	Amondys 45 approved under accelerated approval
Orphan-drug exclusivity	Generally through February 25, 2028	Blocks approval of the same drug for the same disease or condition, subject to statutory exceptions
Listed US patent	Nominally January 2031	Patent-based blocking right, subject to term adjustments and litigation
Six-month pediatric extension	Potentially available if statutory requirements are met	Could extend qualifying regulatory exclusivity or patent protection

Orphan-drug exclusivity and patent protection operate independently. A generic or competing product can face different barriers depending on whether it is the same drug, uses a different application pathway, or challenges the patent before the orphan period ends.

The accelerated approval status also creates a regulatory risk distinct from patent risk. Failure to verify clinical benefit can lead to additional FDA action, including labeling restrictions, withdrawal proceedings, or other regulatory measures. (U.S. Food and Drug Administration, 2021a)

Are there Paragraph IV challenges to US 9,447,415?

No widely reported public Paragraph IV litigation against US 9,447,415 for casimersen has been identified in the principal public records through the available reporting period.

The absence of public litigation does not establish that no certification has been submitted. ANDA certifications and notice letters can precede public court filings, and confidential commercial disputes may not appear in published litigation databases.

The commercial incentive for a Paragraph IV challenge is limited before the end of orphan-drug exclusivity unless an applicant can establish a viable approval strategy. The patent remains the more important long-term barrier after orphan exclusivity expires.

What other patents may cover casimersen and exon 45 skipping?

The casimersen patent estate should be analyzed as a family rather than by relying on US 9,447,415 alone.

Composition patents

Composition patents can cover:

The specific casimersen sequence.
Overlapping antisense sequences.
Morpholino backbone chemistry.
Salt forms.
Stereochemical or structural variants.
Chemically modified analogues.

US 9,447,415 is strongest against morpholino compounds that preserve the claimed exon 45 target segment and length range.

Formulation patents

Formulation claims may cover:

Injectable aqueous solutions.
Concentration ranges.
pH and buffering systems.
Stabilizers and tonicity agents.
Container or vial presentations.
Storage conditions.

The claims supplied for US 9,447,415 do not recite these formulation details. A separate formulation patent would therefore be required to create meaningful protection around a particular commercial presentation.

Method-of-use patents

Potential use claims may address:

Treating Duchenne muscular dystrophy.
Treating patients with mutations amenable to exon 45 skipping.
Increasing dystrophin expression.
Improving muscle function.
Particular dosing regimens.
Use in defined age or mutation subgroups.

The supplied claims are not limited to treatment of a named disease. Their functional requirement is exon 45 skipping, not a clinical treatment outcome.

Manufacturing and process patents

Manufacturing protection may cover:

Solid-phase synthesis of morpholino oligomers.
Purification and impurity control.
Scale-up procedures.
Conjugation or derivatization.
Sterile filtration and fill-finish.
Analytical methods for identity and purity.

These patents can delay or increase the cost of generic entry even when a challenger avoids the composition claims.

How strong is the patent estate for casimersen?

The estate has relatively strong product-specific protection but limited breadth outside the claimed chemistry and sequence architecture.

Risk factor	Assessment
Sequence specificity	Strong against close morpholino variants targeting the claimed window
Chemistry limitation	Narrows the claim against non-morpholino antisense platforms
Length range	Creates a defined boundary at 20 and 31 bases
Functional limitation	Requires exon 45-skipping activity and may create evidentiary issues
Formulation coverage	Limited in the supplied claims
Method-of-use coverage	Not required by claims 1 and 2
Design-around potential	Possible through alternative chemistry or a different exon 45 target region
Product relevance	High for casimersen if the marketed sequence falls within the claimed scope

A challenger could pursue a non-infringement position based on a different target sequence, a length outside the claimed range, non-morpholino chemistry, or failure to satisfy the 20-base sequence limitation. Validity challenges could focus on anticipation, obviousness, written description, enablement, claim construction, or the support for the exon-skipping functional limitation.

Which companies compete with casimersen?

Casimersen competes primarily within the exon-skipping DMD market rather than against another approved exon 45-skipping product.

Company	Product	Exon	Competitive relevance
Sarepta Therapeutics	Amondys 45, casimersen	45	Direct exon 45 product
Sarepta Therapeutics	Exondys 51, eteplirsen	51	Same platform and disease, different genotype
Sarepta Therapeutics	Vyondys 53, golodirsen	53	Same disease and platform
NS Pharma	Viltepso, viltolarsen	53	Competing exon 53 product
Dyne Therapeutics	Emerging DMD programs	Various	Alternative delivery and genetic approaches
Avidity Biosciences	Emerging RNA programs	Various	Antibody-oligonucleotide delivery approach
Gene therapy developers	Various micro-dystrophin programs	Not exon-specific	Platform competition outside exon skipping

Alternative technologies, including micro-dystrophin gene therapy and antibody-oligonucleotide conjugates, may avoid direct infringement of US 9,447,415 while competing for the same patients and treatment budgets.

What generic entry risks exist?

The principal generic-entry scenarios are:

A conventional ANDA applicant develops a morpholino with the same or overlapping exon 45 sequence and faces a high infringement risk.
A challenger uses a different exon 45 target window and contests whether it contains the claimed 20-base sequence.
A non-morpholino antisense compound attempts to avoid the chemistry limitation.
A rival pursues a different regulatory pathway or an alternative molecular platform.
A generic challenges validity through Paragraph IV litigation.

The strongest design-around opportunity is a compound that preserves exon 45 skipping but uses a different target region or a chemistry outside the morpholino limitation. That strategy would still face separate patent families, regulatory comparability issues, manufacturing complexity, and potential method-of-use or formulation claims.

What licensing and ownership issues affect the patent?

The relevant commercial rights should be traced through the patent assignment chain, not only the original application applicant. Sarepta is the commercial sponsor of Amondys 45 and the associated exon-skipping platform. The patent record should be reviewed for assignments, mergers, security interests, exclusive licenses, and continuation applications.

No public settlement agreement specific to a Paragraph IV challenge against US 9,447,415 is identified in the principal public sources. No publicly reported license has been identified that would eliminate the need to assess Sarepta's direct or controlled rights in the patent family.

Key Takeaways

US 9,447,415 is a morpholino composition patent targeting exon 45 of dystrophin pre-mRNA.
Claim 1 covers 20- to 31-base morpholinos with at least 20 qualifying consecutive bases complementary to the specified exon 45 region.
Claim 2 covers pharmaceutical compositions containing the claimed morpholino and a pharmaceutically acceptable carrier.
The patent is directly relevant to casimersen and Amondys 45.
The nominal patent term extends into January 2031, while orphan-drug exclusivity is generally expected to run through February 2028.
The claims are strong against close sequence and chemistry copies but leave potential design-around paths through alternative chemistry or target regions.
No widely reported public Paragraph IV litigation against this patent has been identified.
Separate formulation, method-of-use, manufacturing, continuation, and foreign-family rights must be evaluated before reaching a complete freedom-to-operate conclusion.

FAQs About US 9,447,415 and Casimersen Patent Protection

Does US 9,447,415 cover all exon 45-skipping drugs?

No. It is limited principally by the morpholino chemistry, the 20- to 31-base length range, the specified exon 45 sequence region, and the exon-skipping functional requirement.

Does the patent cover eteplirsen or golodirsen?

No. Eteplirsen targets exon 51 and golodirsen targets exon 53. They do not satisfy the exon 45 target limitation in the stated claims.

Can a non-morpholino exon 45 antisense drug avoid this patent?

Potentially. The express morpholino limitation creates a possible non-infringement route for a different antisense chemistry, although other patents may apply.

Is Amondys 45 protected by orphan-drug exclusivity as well as patents?

Yes. FDA orphan-drug exclusivity and patent protection are separate rights with different legal standards and expiration calculations.

Does the Orange Book listing prove that the patent is valid?

No. An Orange Book listing identifies patent information submitted for an approved drug. It does not establish patent validity, enforceability, or infringement.

References

U.S. Food and Drug Administration. (2021a). Amondys 45 (casimersen) prescribing information. FDA.
U.S. Food and Drug Administration. (2025). Approved drug products with therapeutic equivalence evaluations: Orange Book. FDA.
United States Patent and Trademark Office. (2016). U.S. Patent No. 9,447,415: Antisense oligonucleotides for inducing exon skipping in dystrophin pre-mRNA. USPTO.
U.S. Food and Drug Administration. (2021b). Accelerated approval program: Casimersen. FDA.

Foriegn Application Priority Data
Foreign Country	Foreign Patent Number	Foreign Patent Date
Australia	2004903474	Jun 28, 2004

Country	Patent Number	Estimated Expiration	Supplementary Protection Certificate	SPC Country	SPC Expiration
Austria	E498685	⤷ Start Trial
Cyprus	1111447	⤷ Start Trial
Cyprus	1117475	⤷ Start Trial
>Country	>Patent Number	>Estimated Expiration	>Supplementary Protection Certificate	>SPC Country	>SPC Expiration

Details for Patent: 9,447,415

Summary for Patent: 9,447,415