US Patent 9,024,007: Claim Scope, Exon 53 Antisense Coverage, and Patent Landscape

US Patent 9,024,007 is directed to a PEG-linked morpholino antisense oligonucleotide that induces exon 53 skipping in dystrophin pre-mRNA. The asserted commercial relevance is narrower than the exon 53 mechanism itself: the independent claims require a 25-base antisense sequence, a defined exon 53 hybridization region, a morpholino chemistry, and covalent attachment to polyethylene glycol. An unmodified PMO drug does not literally satisfy the PEG limitation.

The patent is therefore more relevant to PEG-conjugated exon 53 oligonucleotides, follow-on formulations, and design-around analysis than to every exon 53-skipping product.

What does US Patent 9,024,007 protect?

The patent claims two related subject matters:

Claim	Claimed subject	Practical scope
Claim 1	A PEG-linked 25-base morpholino antisense oligonucleotide	Product claim directed to a defined exon 53-skipping conjugate
Claim 2	A pharmaceutical composition containing that oligonucleotide and a pharmaceutically acceptable carrier	Composition claim covering drug-product presentations containing the claimed conjugate

The core claim elements are cumulative. A potentially infringing molecule must satisfy all material limitations:

It must be an antisense oligonucleotide of 25 bases.
Its sequence must be 100% complementary to 25 consecutive nucleotides in the specified exon 53 target region.
The sequence must contain at least 20 consecutive bases corresponding to SEQ ID NO: 193.
Uracil substitutions in the sequence are treated as thymine bases.
The chemistry must be morpholino.
The oligonucleotide must be chemically linked to a polyethylene glycol chain.
The oligonucleotide must specifically hybridize to dystrophin pre-mRNA and induce exon 53 skipping.
For claim 2, the product must also contain a pharmaceutically acceptable carrier.

The claim is narrower than a general claim to exon 53 skipping, a general claim to PMOs, or a general claim to dystrophin restoration.

What sequence is covered by the patent?

The claimed reference sequence is:

C AUU CAA CUG UUG CCU CCG GUU CUG AAG GUG

With uracil converted to thymine, the corresponding DNA-style sequence is:

CATTCAACTGTTGCCTCCGGTTCTGAAGGTG

The claim requires a 25-base antisense oligonucleotide containing at least 20 consecutive bases from that 31-base sequence. This creates a bounded sequence genus rather than protection for only one exact 25-mer.

Sequence variants potentially within claim 1

The claim can potentially capture multiple 25-base sequences because:

The claimed 25 bases may be selected from an allowed exon 53 target region.
The sequence must contain at least 20 consecutive bases of the stated reference sequence.
The claim requires complete complementarity to the selected 25-nucleotide pre-mRNA segment.
The sequence can include limited terminal or flanking variation, provided the 20-base consecutive-sequence requirement remains satisfied.

The claim does not expressly require a particular backbone substitution pattern, terminal group, dose, route of administration, or PEG molecular weight.

How should the H53A target-region language be interpreted?

The claim identifies annealing sites H53A(+23+47) and H53A(+39+69). The wording supplied for the claim states that the target region is "within annealing site H53A(+23+47) and annealing site H53A(+39+69)."

Read literally as requiring simultaneous location within both coordinate intervals, the intersection would be only positions +39 through +47, which is nine nucleotides and cannot contain a 25-nucleotide target. That creates a claim-construction issue.

The technically coherent interpretations are likely to be one of the following:

the target lies within either of the two annealing sites;
the target lies in the region spanning the two sites; or
the patent text uses "and" to identify alternatives or a range rather than a strict mathematical intersection.

This ambiguity is material in litigation. A court would examine the issued patent, specification, prosecution history, claim amendments, and any disclaimer statements before assigning legal effect to the language. The sequence limitation and the biological requirement for exon 53 skipping may narrow the practical dispute, but they do not eliminate the drafting issue.

Is the PEG limitation commercially important?

Yes. The PEG limitation is the most commercially significant narrowing feature.

The claim requires that the morpholino antisense oligonucleotide be chemically linked to a polyethylene glycol chain. A conventional, unconjugated PMO would generally fail the literal PEG limitation even if it:

has the same 25-base sequence;
binds the same exon 53 region;
induces the same exon skipping; and
is used to treat Duchenne muscular dystrophy.

The patent therefore distinguishes between:

Product type	Likely literal coverage
PEG-linked exon 53 PMO	Potentially within claim scope
Unmodified exon 53 PMO	Generally outside the PEG limitation
PMO linked to a non-PEG polymer	Potentially outside literal scope
Peptide-conjugated PMO	Generally outside literal scope, subject to equivalents analysis
2'-modified RNA oligonucleotide	Outside the morpholino limitation
siRNA or guide RNA	Outside the claimed chemistry and mechanism

A doctrine-of-equivalents theory could be asserted against a non-PEG polymer or another delivery conjugate, but the outcome would depend on prosecution history and whether PEG was added to distinguish prior art. A PEG limitation introduced during prosecution can materially restrict equivalents arguments.

What FDA products and competitors are relevant to the patent?

The principal clinical and commercial competitors are exon 53-skipping morpholino products.

Product	Active technology	Developer or sponsor	Exon target	Relationship to US 9,024,007
Vyondys 53, golodirsen	PMO antisense oligonucleotide	Sarepta Therapeutics	Exon 53	Commercially related mechanism; unconjugated PMO does not inherently meet the PEG limitation
Viltepso, viltolarsen	PMO antisense oligonucleotide	NS Pharma, Nippon Shinyaku	Exon 53	Competing exon 53 PMO; product-specific claim analysis required
PEG-conjugated exon 53 PMO	PEG-linked PMO	Potentially multiple developers	Exon 53	Most directly exposed to the claim language
Peptide- or ligand-conjugated exon 53 oligonucleotide	Conjugated antisense technology	Various developers	Exon 53	May avoid literal PEG coverage but face other patent families

Golodirsen and viltolarsen are approved under the FDA's accelerated approval framework based on dystrophin production as a surrogate endpoint. Their approval does not make every exon 53-skipping molecule infringing. The chemistry, sequence, conjugation, formulation, and claimed use must be analyzed separately. FDA approval is not a patent clearance determination. [1][2]

What is the Orange Book status of US Patent 9,024,007?

The patent's commercial significance depends on whether it is listed for a specific approved product and whether the approved product embodies the PEG limitation.

For an Orange Book listing to create a direct regulatory patent-certification issue, the patent must be listed by the NDA holder for the relevant drug product and must claim the drug, formulation, or an approved method of use. A patent directed to a PEG-linked research or development configuration may not block an ANDA for an unmodified PMO.

The relevant regulatory distinctions are:

Regulatory pathway	Patent relevance
ANDA for a small-molecule generic	Paragraph IV certification may apply to listed patents
ANDA for an oligonucleotide product	Patent and sameness analysis can be more complex than for a conventional small molecule
505(b)(2) application	Applicant may rely partly on listed drug data while addressing listed patents
Biologic biosimilar application	Not the normal pathway for a synthetic PMO
New molecular entity or new oligonucleotide	Original NDA and independent patent strategy may apply

The FDA Orange Book should be read together with the current NDA patent listing, FDA product labeling, and USPTO Patent Center. A patent listed for one exon 53 product would not automatically establish infringement by a different exon 53 product. [3][4]

When does US Patent 9,024,007 lose exclusivity?

The relevant patent term is the statutory term shown in USPTO records, subject to patent-term adjustment, terminal disclaimers, and any patent-term extension.

Public patent records identify US 9,024,007 as an exon 53 dystrophin antisense patent issued on April 28, 2015. Its term analysis should use the effective US nonprovisional or PCT filing date rather than the earliest priority date alone. On a 20-year baseline calculation from a 2011 US/PCT filing, the unadjusted term would run to approximately June 2031. The exact enforceable date depends on USPTO patent-term adjustment and any later terminal-disclaimer information. [5][6]

The regulatory exclusivity period is separate:

Patent term is determined under 35 U.S.C. §§ 154 and 156.
New-drug exclusivity is determined under the Federal Food, Drug, and Cosmetic Act.
Accelerated approval does not itself extend the patent term.
Orphan-drug exclusivity may prevent approval of a competing product for the same use during its statutory period, subject to the scope of the orphan designation.

Patent expiry and FDA exclusivity therefore should not be treated as the same date.

What Paragraph IV challenges and litigation risks exist?

A future generic or follow-on applicant could challenge a listed patent through a Paragraph IV certification if US 9,024,007 is listed for the relevant reference product. The principal challenge theories would likely include:

Non-infringement

A challenger could argue that its product:

is not linked to PEG;
uses a different morpholino sequence;
lacks 20 consecutive bases from SEQ ID NO: 193;
targets a different exon 53 region;
does not use the claimed morpholino chemistry; or
does not meet the asserted hybridization or exon-skipping limitation.

The PEG limitation provides a strong literal non-infringement position for an unconjugated PMO.

Invalidity

Potential invalidity theories include:

indefiniteness based on the relationship between the two H53A sites;
lack of written description for the claimed sequence genus;
lack of enablement across all 25-base sequences satisfying the 20-base requirement;
anticipation by earlier exon 53 antisense sequences;
obviousness based on known PMO exon-skipping and PEG-conjugation technology;
lack of patentable distinction between the claimed sequence and disclosed annealing sites.

The biological requirement that the compound "induce exon 53 skipping" may create a functional limitation. It could support validity by restricting the claim to active molecules, but it could also create evidentiary disputes over assay conditions, threshold activity, and reproducibility.

Prosecution-history estoppel

If the PEG or sequence limitations were added to overcome prior art, the patentee may face restrictions when asserting equivalents against non-PEG conjugates or materially different sequences. The prosecution history is therefore more important than the issued claims alone.

How strong is the patent estate for exon 53 products?

US 9,024,007 appears strongest against a product that combines all of the following:

a 25-base PMO;
the claimed exon 53 sequence core;
a target in the H53A-defined region;
covalent PEG attachment; and
a pharmaceutical composition containing the conjugate.

Its strength is lower against approved or conventional unconjugated exon 53 PMOs. Those products may still face other patents covering:

specific antisense sequences;
PMO backbone chemistry;
exon-skipping methods;
dosing regimens;
formulations;
manufacturing processes;
conjugation chemistry;
treatment of dystrophinopathies; and
combination or redosing protocols.

The patent is best characterized as a focused composition and product-configuration patent, not as a broad platform patent covering all exon 53 skipping.

What formulation and manufacturing barriers remain?

Claim 2 requires a pharmaceutical composition with a pharmaceutically acceptable carrier, but it does not specify:

pH;
buffer identity;
tonicity;
concentration;
container closure;
route of administration;
injection volume;
preservative;
storage condition; or
PEG molecular weight.

Those omissions can support design-around work at the formulation level. Separate formulation patents could still protect a particular injectable composition, stability profile, dosing concentration, or container system.

Manufacturing risks may arise from:

sequence-specific impurity profiles;
stereochemical or backbone purity;
PEG conjugation efficiency;
unconjugated PMO removal;
chain-length distribution;
aggregation;
residual solvents and reagents;
analytical characterization; and
process consistency.

These issues may delay market entry even where a competitor avoids literal infringement. They are regulatory and CMC barriers rather than necessarily barriers created by US 9,024,007.

What generic launch scenarios exist?

Scenario 1: Unmodified PMO launch

An unmodified exon 53 PMO could have a credible non-infringement position against the PEG limitation. It would still need to address other listed patents, FDA requirements, clinical-bridging issues, and possible use-patent claims.

Scenario 2: Non-PEG conjugate launch

A peptide-, lipid-, or ligand-conjugated PMO may avoid literal infringement. Risk would increase if the patent owner argues that the substitute conjugate is equivalent to PEG or that the prosecution history does not bar that theory.

Scenario 3: Same sequence with different chemistry

A non-morpholino oligonucleotide using the same target sequence would likely avoid the literal morpholino limitation. Other antisense patent families could remain relevant.

Scenario 4: PEG-linked product with a redesigned sequence

A redesigned sequence may avoid the 20-consecutive-base limitation, but it must also avoid the claimed target-region limitations. Exon 53 biology limits the available design space, making sequence redesign more difficult than chemistry redesign.

Scenario 5: PEG-linked product after patent expiry

Entry after the enforceable patent term would remove the patent's blocking effect, subject to other unexpired patents, regulatory exclusivity, and continuing trade-secret or manufacturing constraints.

Key Takeaways

US 9,024,007 claims a PEG-linked morpholino antisense oligonucleotide and a composition containing it.
The claim requires a 25-base exon 53-targeting sequence with at least 20 consecutive bases from SEQ ID NO: 193.
The PEG limitation materially narrows literal infringement exposure.
Conventional unconjugated exon 53 PMOs do not automatically fall within the claims.
Claim 2 adds a carrier requirement but does not specify a narrow formulation.
The H53A coordinate language presents a potential claim-construction issue because the stated intervals do not contain a common 25-nucleotide segment if read literally.
The patent is more important for PEG-conjugated exon 53 programs than for golodirsen- or viltolarsen-type unconjugated PMOs.
Paragraph IV exposure depends on current Orange Book listing and whether the proposed product practices every asserted limitation.
Patent expiry must be calculated from the effective US filing date and adjusted for USPTO patent-term adjustment.
No biosimilar pathway is ordinarily expected for a synthetic PMO; follow-on products would more likely use an NDA, ANDA, or 505(b)(2) strategy depending on product characteristics.

FAQs

Does US 9,024,007 cover golodirsen?

Not necessarily. Golodirsen is an exon 53-skipping PMO, but the supplied claims require chemical linkage to PEG. An unconjugated golodirsen product would not literally satisfy that limitation.

Can a competitor avoid the patent by using a peptide-conjugated PMO?

Potentially. A peptide-conjugated PMO may avoid the express PEG limitation, although the patent owner could assert other patents or a doctrine-of-equivalents theory.

Does the patent cover all exon 53 antisense sequences?

No. The claims are limited by sequence, target-region, morpholino, PEG-conjugation, and exon-skipping requirements.

Is US 9,024,007 a biosimilar barrier?

No. Synthetic PMOs are not ordinarily regulated through the biosimilar pathway. The patent is more relevant to generic, follow-on, 505(b)(2), or independent NDA strategies.

What is the highest-risk design for infringement?

A 25-base PEG-linked morpholino containing at least 20 consecutive bases from the claimed SEQ ID NO: 193 core and targeting the identified exon 53 region presents the highest literal infringement risk.

References

U.S. Food and Drug Administration. (2019). FDA approves targeted treatment for rare Duchenne muscular dystrophy mutation. https://www.fda.gov
U.S. Food and Drug Administration. (2020). Viltepso prescribing information. https://www.accessdata.fda.gov
U.S. Food and Drug Administration. (2024). Approved drug products with therapeutic equivalence evaluations, Orange Book. https://www.accessdata.fda.gov
U.S. Food and Drug Administration. (2024). Approved drug product labeling and patent-listing resources. https://www.fda.gov
United States Patent and Trademark Office. (2015). US Patent No. 9,024,007, Antisense oligonucleotide for inducing exon skipping in dystrophin pre-mRNA. https://patents.google.com
United States Patent and Trademark Office. (2024). Patent Center and patent term adjustment information. https://patentcenter.uspto.gov

Foriegn Application Priority Data
Foreign Country	Foreign Patent Number	Foreign Patent Date
Australia	2004903474	Jun 28, 2004

Country	Patent Number	Estimated Expiration	Supplementary Protection Certificate	SPC Country	SPC Expiration
Austria	E498685	⤷ Start Trial
Cyprus	1111447	⤷ Start Trial
Cyprus	1117475	⤷ Start Trial
Germany	602005026386	⤷ Start Trial
Denmark	1766010	⤷ Start Trial
>Country	>Patent Number	>Estimated Expiration	>Supplementary Protection Certificate	>SPC Country	>SPC Expiration

Details for Patent: 9,024,007

Summary for Patent: 9,024,007