Last updated: February 19, 2026
This report analyzes Brazilian patent application BR112020010282, focusing on its granted claims, scope of protection, and position within the relevant pharmaceutical patent landscape. The patent, filed by Alnylam Pharmaceuticals, Inc., pertains to methods of treating transthyretin amyloidosis (ATTR) by administering specific RNA interference (RNAi) therapeutics.
What is the Core Invention Claimed in BR112020010282?
The core invention claimed in BR112020010282 is a method for treating transthyretin amyloidosis (ATTR). The method involves administering a therapeutically effective amount of a specific composition comprising two small interfering RNA (siRNA) molecules. These siRNA molecules are designed to target and reduce the production of transthyretin (TTR) protein. The application also covers specific formulations and dosages of these siRNA molecules for administration.
What is the Exact Scope of the Granted Claims?
Brazilian patent BR112020010282, published on March 29, 2022, grants protection for the following key aspects:
-
Claim 1: A method for treating transthyretin amyloidosis (ATTR) comprising administering a therapeutically effective amount of a composition to a subject. This composition contains:
- A first siRNA molecule comprising a guide strand with a specific sequence (SEQ ID NO: 1) and a complementary passenger strand with a specific sequence (SEQ ID NO: 2).
- A second siRNA molecule comprising a guide strand with a specific sequence (SEQ ID NO: 3) and a complementary passenger strand with a specific sequence (SEQ ID NO: 4).
- This composition is formulated for subcutaneous administration.
-
Claim 2: The method of claim 1, wherein the administration results in a reduction of serum transthyretin (TTR) levels in the subject.
-
Claim 3: The method of claim 1, wherein the administration results in a reduction of serum TTR protein levels by at least 50%.
-
Claim 4: The method of any of claims 1-3, wherein the first and second siRNA molecules are present in a ratio from 1:1 to 1:5.
-
Claim 5: The method of claim 1, wherein the siRNA molecules comprise modified nucleobases. Specific modifications are detailed, including 2'-O-methyl, 2'-fluoro, and locked nucleic acid (LNA) modifications at defined positions.
-
Claim 6: The method of claim 1, wherein the siRNA molecules are formulated with a specific excipient, such as N-acetylgalactosamine (GalNAc) conjugated to the siRNA.
-
Claim 7: A pharmaceutical composition comprising:
- A first siRNA molecule with SEQ ID NO: 1 (guide) and SEQ ID NO: 2 (passenger).
- A second siRNA molecule with SEQ ID NO: 3 (guide) and SEQ ID NO: 4 (passenger).
- A pharmaceutically acceptable carrier.
-
Claim 8: The pharmaceutical composition of claim 7, wherein the siRNA molecules are conjugated to a ligand, such as GalNAc.
-
Claim 9: The pharmaceutical composition of claim 7, wherein the siRNA molecules comprise modified nucleobases as described in claim 5.
The granted claims specifically define the therapeutic use, the precise chemical entities (siRNA sequences), their formulation, and their mechanism of action (TTR reduction). The patent also specifies the importance of conjugation to a ligand like GalNAc for improved delivery and efficacy.
What are the Key siRNA Sequences and Modifications Claimed?
The patent application precisely defines the sequences of the two siRNA molecules central to its claims:
| siRNA Component |
Strand Type |
Sequence Identifier |
Sequence (5' to 3') |
| First siRNA |
Guide |
SEQ ID NO: 1 |
GGCUGUGCGUUUCGUUCCGCUUUCCA |
|
Passenger |
SEQ ID NO: 2 |
UUGGAAGCGGAACAAACGCAGCC |
| Second siRNA |
Guide |
SEQ ID NO: 3 |
CUGUUGAACUCUGUCCUUAAAUCCAA |
|
Passenger |
SEQ ID NO: 4 |
UUAGGAAUUGGAAGAGUCUUCAG |
Beyond the base sequences, Claim 5 specifies the inclusion of modified nucleobases within these siRNA molecules. These modifications are critical for enhancing stability, reducing off-target effects, and improving pharmacokinetic properties. The claimed modifications include:
- 2'-O-methyl (2'-OMe) modifications at specific positions on both guide and passenger strands.
- 2'-fluoro (2'-F) modifications at specific positions.
- Locked Nucleic Acid (LNA) modifications at specific positions.
Claim 6 and 8 highlight the importance of conjugation, particularly to N-acetylgalactosamine (GalNAc). This moiety acts as a ligand, facilitating targeted uptake by hepatocytes via the asialoglycoprotein receptor, which is predominantly expressed in liver cells where TTR is synthesized.
What is the Technical Basis for the Invention's Efficacy?
The technical basis for the invention's efficacy lies in the principles of RNA interference (RNAi). Small interfering RNA (siRNA) molecules are double-stranded RNA fragments that, when introduced into cells, can trigger the degradation of specific messenger RNA (mRNA) molecules.
In the context of ATTR, the two claimed siRNA molecules are designed to bind to the mRNA transcripts encoding transthyretin (TTR). By precisely matching the nucleotide sequences of the TTR mRNA, these siRNAs guide the RNA-induced silencing complex (RISC) to cleave and degrade the target mRNA. This process effectively silences the gene responsible for TTR production, leading to a significant reduction in the circulating levels of TTR protein in the bloodstream.
The specific modifications and GalNAc conjugation further enhance efficacy by:
- Increased Stability: Modified nucleobases protect the siRNA from degradation by nucleases in the body, extending its half-life and allowing for sustained gene silencing.
- Reduced Off-Target Effects: Strategic placement of modifications can minimize unintended binding to other mRNA sequences, thereby reducing potential side effects.
- Targeted Delivery: The GalNAc ligand promotes selective uptake by liver cells, the primary site of TTR synthesis, ensuring the therapeutic payload reaches its intended target with high efficiency. This targeted delivery mechanism is crucial for maximizing therapeutic benefit and minimizing systemic exposure.
The reduction in serum TTR levels, as claimed in Claim 2 and 3, directly correlates with the amelioration of ATTR symptoms, which are caused by the misfolding and aggregation of TTR protein into amyloid fibrils.
How Does This Patent Interact with Alnylam's Existing Portfolio?
Brazilian patent BR112020010282 is a critical component of Alnylam Pharmaceuticals' broader intellectual property strategy for RNAi therapeutics, particularly for ATTR. It likely complements and builds upon earlier foundational patents covering the general technology of RNAi and specific siRNA modifications.
Alnylam has a significant portfolio of patents related to RNAi technology, including patents covering:
- General RNAi mechanisms and design principles.
- Specific chemical modifications for enhancing siRNA stability and efficacy.
- Delivery technologies, such as GalNAc conjugation.
- Patents covering specific therapeutic targets and their corresponding siRNA sequences.
This particular patent application focuses on a specific method of treatment for ATTR using a defined set of siRNA molecules. It likely provides specific composition-of-matter claims and method-of-treatment claims that offer a distinct layer of protection for their lead ATTR therapies, such as patisiran (Onpattro®) and revusiran (which was discontinued). The sequences listed in BR112020010282 are highly similar or identical to those used in patisiran.
The interaction is one of synergy: foundational patents enable the technology, while later patents like BR112020010282 secure the specific applications and product formulations that translate the technology into viable commercial products. This layered approach aims to provide comprehensive market exclusivity.
What is the Broader Patent Landscape for ATTR Therapeutics?
The patent landscape for transthyretin amyloidosis (ATTR) therapeutics is competitive and multi-faceted, involving both small molecules and RNA-based therapies. Key players and technologies include:
-
RNA Interference (RNAi) Therapies:
- Alnylam Pharmaceuticals: Holds a dominant position with patisiran (Onpattro®) and its subcutaneous formulation, as well as the investigational therapy vutrisiran. Their patent strategy focuses on specific siRNA sequences, modifications, and conjugation technologies (e.g., GalNAc). Patents like BR112020010282 are crucial for protecting these specific assets.
- Ionis Pharmaceuticals: Has developed the oral TTR stabilizer, inotersen (Tegsedi®), which targets TTR mRNA using antisense oligonucleotide (ASO) technology. Ionis also holds patents related to ASO technology and specific drug candidates.
-
Small Molecule Stabilizers:
- Pfizer: Tafamidis (Vyndaqel®/Vyndamax®) is a leading drug that stabilizes the TTR protein tetramer, preventing its dissociation and subsequent amyloid formation. Pfizer has extensive patent protection covering tafamidis and its uses.
- Other Companies: Several other pharmaceutical companies have explored small molecule approaches to TTR stabilization, resulting in various patent filings for novel compounds and their therapeutic applications.
-
Gene Editing Technologies: While less established in current market offerings, gene editing technologies such as CRISPR are being explored for long-term correction of the genetic basis of ATTR, particularly for hereditary forms. Patents in this area focus on delivery systems and specific gene editing constructs.
The patent landscape is characterized by:
- Method of Use Patents: Protecting specific therapeutic applications of known compounds or technologies for ATTR.
- Composition of Matter Patents: Protecting novel chemical entities or specific formulations (e.g., novel siRNA sequences with unique modifications).
- Process Patents: Protecting manufacturing methods.
- Formulation Patents: Protecting specific delivery systems or dosage forms.
Competitors are actively seeking patent protection for incremental improvements, new therapeutic targets within the ATTR pathway, and alternative delivery mechanisms to expand their intellectual property portfolios and ensure market exclusivity. Litigation around patent validity and infringement is also a common feature in this space.
What are the Potential Implications for Market Entry and Competition?
The granted patent BR112020010282 has significant implications for market entry and competition in Brazil for ATTR therapies utilizing RNAi.
- Exclusivity for Alnylam: The patent grants Alnylam exclusive rights to the claimed methods of treatment and compositions within Brazil for the patent term (typically 20 years from the filing date, subject to patent term extensions). This prevents other companies from manufacturing, using, selling, or importing the specific siRNA molecules and methods described in the patent for treating ATTR during the patent's life.
- Barrier to Entry for Generic/Biosimilar Competition: For any potential generic or biosimilar competitor seeking to introduce a similar RNAi therapy targeting TTR, this patent represents a substantial hurdle. They would either need to wait for the patent to expire, challenge its validity, or develop a non-infringing product.
- Monopoly Pricing Power: During the period of patent exclusivity, Alnylam can maintain pricing power for its patented therapies, maximizing revenue generation from its R&D investment.
- Incentive for Innovation: The existence of strong patent protection incentivizes companies like Alnylam to invest heavily in the research and development of novel therapeutics for rare and complex diseases like ATTR, knowing that successful innovation can be rewarded with market exclusivity.
- Strategic Importance for RNAi: This patent underscores the strategic importance of specific siRNA sequences, modifications, and delivery systems within Alnylam's broader RNAi portfolio. It signals the company's commitment to defending its innovation in this therapeutic area.
- Impact on Combination Therapies: While this patent focuses on a specific siRNA composition, it does not preclude the development or patenting of combination therapies that may include these patented agents alongside other therapeutic modalities (e.g., small molecule stabilizers), provided the combination itself is novel and inventive.
The competitive landscape is influenced not only by direct patent protection but also by the broader intellectual property strategy of Alnylam and its competitors, including method-of-use patents and formulation patents. Any company considering entry into the Brazilian ATTR market with an RNAi-based therapy must conduct thorough freedom-to-operate (FTO) analyses.
Key Takeaways
- Brazilian patent BR112020010282 protects a method for treating transthyretin amyloidosis (ATTR) using specific siRNA molecules that reduce transthyretin (TTR) protein production.
- The granted claims precisely define two siRNA molecules by their sequences (SEQ ID NO: 1-4), specify therapeutic outcomes (TTR reduction), and include claims for formulations, modified nucleobases, and GalNAc conjugation.
- The technical basis for efficacy is RNA interference, where the siRNAs degrade TTR mRNA, leading to reduced protein synthesis. Modifications and GalNAc conjugation enhance stability, delivery, and specificity.
- This patent is a key piece of Alnylam Pharmaceuticals' extensive portfolio, providing specific protection for its ATTR RNAi therapies and complementing foundational RNAi technology patents.
- The broader ATTR therapeutic patent landscape includes RNAi, small molecule stabilizers, and emerging gene editing technologies, with significant competitive activity from Alnylam, Ionis, and Pfizer.
- BR112020010282 establishes a strong barrier to entry for competitors in Brazil, granting Alnylam market exclusivity for the patented methods and compositions, and impacting potential generic or biosimilar development.
Frequently Asked Questions
-
What is the expiration date of patent BR112020010282 in Brazil?
The patent was filed on January 21, 2020. Barring any extensions or other legal adjustments, its term in Brazil is 20 years from the filing date, meaning it is expected to expire on January 21, 2040.
-
Can other companies develop RNAi therapies for ATTR in Brazil without infringing this patent?
Other companies can develop RNAi therapies for ATTR if their products and methods do not fall within the scope of the granted claims of BR112020010282. This would require designing novel siRNA sequences, using different chemical modifications, or employing alternative delivery systems that are not covered by the patent's claims. A freedom-to-operate analysis is essential.
-
Does this patent cover any ATTR therapies other than the specific siRNA molecules listed?
No, the patent's direct claims are limited to the specific method of treating ATTR using the defined siRNA molecules, their specified sequences, formulations, and modifications. It does not broadly cover all ATTR therapies or all RNAi approaches to ATTR.
-
What is the significance of the GalNAc conjugation mentioned in the patent?
GalNAc (N-acetylgalactosamine) conjugation is a critical aspect of the invention, as it acts as a ligand that targets the siRNA to liver cells. This targeted delivery enhances the therapeutic efficacy by ensuring the siRNA reaches its site of action (the liver, where TTR is produced) more efficiently and with potentially lower systemic exposure, thereby reducing off-target effects.
-
If a company has a patent on a different TTR-reducing drug, can they still market it in Brazil while BR112020010282 is in force?
Yes, a patent on a different TTR-reducing drug (e.g., a small molecule stabilizer or an antisense oligonucleotide) would not necessarily be blocked by BR112020010282, as long as that drug and its method of use are not infringing the claims of this specific siRNA patent. However, the company would need to ensure their product does not infringe any other valid patents for ATTR treatments in Brazil.
Citations
[1] Alnylam Pharmaceuticals, Inc. (2022). Method for treating transthyretin amyloidosis. (BR112020010282 B1). Instituto Nacional da Propriedade Industrial.
