Claims for Patent: 9,902,997

Summary for Patent: 9,902,997

Title:	Kit comprising a polynucleotide probe for detecting a target nucleic acid
Abstract:	The present invention provides a method for detecting a target nucleic acid that comprises a step of providing a sample; contacting the sample with a polynucleotide probe comprising a first sequence and a second sequence complementary to the target nucleic acid; and adding a nuclease for cleaving the second sequence of the polynucleotide probe. The present invention further provides a polynucleotide probe for detecting a target nucleic acid that comprises a first sequence and a second sequence complementary to the target nucleic acid. Moreover, the present invention provides a kit for detecting a target nucleic acid.
Inventor(s):	Ho; Ja-An A. (Taipei, TW), Jou; Amily F. (Taipei, TW), Ou; Yen-Chuan (Taipei, TW), Wang; Shian-Shiang (Taipei, TW), Willner; Itamar (Taipei, TW), Hsu; Shih-Lan (Taipei, TW)
Assignee:	National Taiwan University (Taipei, TW)
Application Number:	14/538,695
Patent Claims:	1. A kit for detecting a target nucleic acid, comprising, in a reaction mixture: a polynucleotide probe; a nuclease; a telomerase; and a magnesium-containing buffer, wherein the polynucleotide probe comprises a polynucleotide connected to a nanoparticle and an acceptor at two ends of the polynucleotide, respectively, wherein the nanoparticle has an optical property and transfers energy to the acceptor to trigger-on a luminescence change, and wherein the acceptor is a luminescent dye or a quencher, and the polynucleotide comprises: a first sequence; and a second sequence complementary to the target nucleic acid, wherein the first sequence is a telomerase primer that is at least three continuous nucleotides complementary to CAAUCCCAAUC (SEQ ID NO. 1) and the second sequence is CCATCTTTACCAGACAGTGTTA (SEQ ID NO. 20). 2. The kit according to claim 1, wherein the nuclease is a duplex-specific nuclease. 3. The kit according to claim 1, wherein the reaction mixture further comprises an optically active molecule or hemin. 4. The kit according to claim 1 wherein the reaction mixture further comprises a reagent that contains luminal and H.sub.2O.sub.2 or contains ABTS and H.sub.2O.sub.2. 5. The kit according to claim 1, the telomerase primer is at least three continuous nucleotides selected from TTAGGG (SEQ ID NO. 6). 6. The kit according to claim 1, wherein the nanoparticle comprises one selected from the group consisting of core-type quantum dot, a core-shell quantum dot, an alloyed quantum dot and a combination thereof. 7. The kit according to claim 6, wherein the nanoparticle is a CdSe/ZnS quantum dot. 8. The kit according to claim 1, wherein the acceptor is BHQ2 or Cy5.

Details for Patent 9,902,997

Applicant	Tradename	Biologic Ingredient	Dosage Form	BLA	Approval Date	Patent No.	Expiredate
Recordati Rare Diseases, Inc.	PANHEMATIN	hemin for injection	For Injection	101246	07/20/1983		2040-01-28