Claims for Patent: 9,163,242

Summary for Patent: 9,163,242

Title:	HER2 nucleic acid aptamers
Abstract:	The present invention relates to optimized HER2 aptamers and methods of using these aptamers.
Inventor(s):	Giangrande; Paloma H. (Iowa City, IA), McNamara; James O. (Iowa City, IA), Thiel; Kristina W. (Iowa City, IA), Thiel; William (Iowa City, IA), Rockey; William M. (Iowa City, IA)
Assignee:	University of Iowa Research Foundation (Iowa City, IA)
Application Number:	13/697,498
Patent Claims:	1. An aptamer molecule not more than 55 nucleotides in length comprising the nucleic acid sequence 5'-GGGAGGACGAUGCGG-R.sup.1-CAGACGACUCGCCCGA-3' (SEQ ID NO: 45), wherein R.sup.1 is TABLE-US-00006 (A1, SEQ ID NO: 1) GACUGUACGGGGCUCUGUG, (A2, SEQ ID NO: 2) GACUGUAUGGGGCUCUGUG, (A3, SEQ ID NO: 3) GACUGUACGGGCUCUGUG, (A4, SEQ ID NO: 4) UCUCAGUAGUGGGCCUGCUG, (A5, SEQ ID NO: 5) GACUGUAUGGGCUCUGUG, (A6, SEQ ID NO: 6) GACUGUAUCGGGGCUCUGUG, (A-consensus, SEQ ID NO: 7) GACUGUAYGGGGCUCUGUG, (D1, SEQ ID NO: 8) AUGUAUGUUGGGAGCCACGC, (D2, SEQ ID NO: 9) CUGUAUGUUGGUAGCCACGC, (D3, SEQ ID NO: 10) UCUGUGUGGGAUGUGGCCC, (D-consensus, SEQ ID NO: 11) AUGUAUGUUGGGAGCCACGC, (B1, SEQ ID NO: 12) UCUGUUGUGCUUGAUAUGCCC, (B2, SEQ ID NO: 13) UGGUGUGUCAAGGUACGCGC, (B3, SEQ ID NO: 14) UCUGCUGUGCUUGAUAUGCCC, (B-consensus, SEQ ID NO: 15) UCUGUUGUGCUUGAUAUGCCC, (C1, SEQ ID NO: 16) CUGUCUACCUUCUACUGCCG, (C2, SEQ ID NO: 17) CCAGUUUACCUUACACUCGC, (C3, SEQ ID NO: 18) CGAUGCUUACGUGCACGCGC, (C4, SEQ ID NO: 19) CUGUCUACCUUCUACUGCCC, (C5, SEQ ID NO: 20) UUGUCUACCUUCUACUGCCG, (C-consensus, SEQ ID NO: 21) CUGUCUWMGCUUCUACUGCCG, (E1, SEQ ID NO: 22) UCCUGUCGUCUGUUCGUCCC, (E2, SEQ ID NO: 23) CCGUGUCGUCUGUACUGCCC, or (E-consensus, SEQ ID NO: 24) UCCUGUCGUYUGKUCSKCCC. 2. The aptamer of claim 1, wherein the nucleic acid molecule comprises nucleic acid 5'-GGGAGGACGAUGCGGGACUGUAYGGGGCUCUGUGCAGACGACUCGCCCGA-3' (SEQ ID NO: 25); 5'-GGGAGGACGAUGCGGUCUGUUGUGCUUGAUAUGCCCCAGACGACUCGCCCGA-3' (SEQ ID NO: 26); 5'-GGGAGGACGAUGCGGCUGUCUWMGCUUCUACUGCCGCAGACGACUCGCCCGA-3' (SEQ ID NO: 27); 5'-GGGAGGACGAUGCGGAUGUAUGUUGGGAGCCACGCCAGACGACUCGCCCGA-3' (SEQ ID NO: 28); or 5'-GGGAGGACGAUGCGGUCCUGUCGUYUGKUCSKCCCCAGACGACUCGCCCGA-3' (SEQ ID NO: 29). 3. A conjugate comprising the aptamer of claim 1 operably linked to a Bcl-2 RNAi molecule. 4. The conjugate of claim 3, wherein the Bcl-2 RNAi molecule comprises nucleic acid 5'-GCUGUCACAGAGGGGCUACUU-3' (SEQ ID NO: 30). 5. The conjugate of claim 4, consisting of 5'-GGGAGGACGAAUGCGGGACUGUACGGGGCUCUGUGCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUAC- UU-3' (A1-Bcl-2, SEQ ID NO:32); 5'-GGGAGGACGAUGCGGGACUGUAUGGGGCUCUGUGCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUACU- U-3' (A2-Bcl-2, SEQ ID NO:33); 5'-GGGAGGACGAUGCGGGACUGUACGGGCUCUGUGCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUACUU- -3' (A3-Bcl-2, SEQ ID NO:34); 5'-GGGAGGACGAUGCGGUCUGUUGUGCUUGAUAUGCCCCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUA- CUU-3' (B1-Bcl-2, SEQ ID NO:35); 5'-GGGAGGACGAUGCGGUGGUGUGUCAAGGUACGCGCCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUAC- UU-3' (B2-Bcl-2, SEQ ID NO:36); 5'-GGGAGGACGAUGCGGUCUGCUGUGCUUGAUAUGCCCCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUA- CUU-3' (B3-Bcl-2, SEQ ID NO:37); 5'-GGGAGGACGAUGCGGCUGUCUACCUUCUACUGCCGCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUAC- UU-3' (C1-Bcl-2, SEQ ID NO:38); 5'-GGGAGGACGAUGCGGCGAUGCUUACGUGCACGCGCCAGACGAACUCGCCCGAGCUGUCACAGAGGGGCUA- CUU-3' (C2-Bcl-2, SEQ ID NO:39); 5'-GGGAGGACGAUGCGGCGAUGCUUACGUGCACGCGCCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUAC- UU-3' (C3-Bcl-2, SEQ ID NO:40); 5'-GGGAGGACGAUGCGGAUGUAUGUUGGGAGCCACGCCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUAC- UU-3' (D1-Bcl-2, SEQ ID NO:41); 5'-GGGAGGACGAUGCGGCUGUAUGUUGGUAGCCACGCCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUAC- UU-3' (D2-Bcl-2, SEQ ID NO:42); 5'-GGGAGGACGAUGCGGUCUGUGUGGGAUGUGGCCCCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUACU- U-3' (D3-Bcl-2, SEQ ID NO:43); or 5'-GGGAGGACGAUGCGGUCCUGUCGUCUGUUCGUCCCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUACU- U-3' (E1-Bcl-2, SEQ ID NO:44). 6. The conjugate of claim 4 hybridized to 5'-GUAGCCCCUCUGUGACAGCUU-3' (SEQ ID NO:31). 7. A complex comprising the aptamer of claim 1 linked to a therapeutic or diagnostic molecule. 8. The complex of claim 7, wherein the aptamer is linked to a therapeutic molecule, and the therapeutic molecule is a siRNA molecule. 9. The complex of claim 8, wherein the siRNA has a guide strand and a passenger strand, and wherein the guide strand is linked to the nucleic acid molecule. 10. The complex of claim 7, which further comprises a PEG molecule. 11. The complex of claim 10, wherein the PEG molecule has an average molecular weight of about 10 to 100 kDa in size. 12. A nucleic acid molecule encoding the aptamer of claim 1. 13. An expression cassette comprising the molecule of claim 12. 14. The expression cassette of claim 13, further comprising a promoter. 15. A viral vector comprising the expression cassette of claim 13. 16. A pharmaceutical composition comprising the aptamer of claim 1. 17. A method for delivering a therapeutic or diagnostic molecule to a cell having a HER2 receptor, comprising contacting the cell with the aptamer of claim 1. 18. A method for treating a patient having cancer comprising administering the aptamer of claim 1 to the patient. 19. The method of claim 18, further comprising administering Herceptin.

Details for Patent 9,163,242

Applicant	Tradename	Biologic Ingredient	Dosage Form	BLA	Approval Date	Patent No.	Expiredate
Genentech, Inc.	HERCEPTIN	trastuzumab	For Injection	103792	09/25/1998		2030-05-14
Genentech, Inc.	HERCEPTIN	trastuzumab	For Injection	103792	02/10/2017		2030-05-14