Claims for Patent: 6,902,896

Summary for Patent: 6,902,896

Title:	Intron associated with myotonic dystrophy type 2 and methods of use
Abstract:	The present invention provides methods for identifying individuals not at risk for developing myotonic dystrophy type 2 (DM2), and individuals that have or are at risk for developing DM2. The present invention also provides isolated polynucleotides that include a repeat tract within intron 1 of the zinc finger protein 9.
Inventor(s):	Ranum; Laura P. W. (St. Paul, MN), Day; John W. (Minneapolis, MN), Liquori; Christina (Minneapolis, MN)
Assignee:	Regents of the University of Minnesota (Minneapolis, MN)
Application Number:	10/143,266
Patent Claims:	1. A method for detecting a polynucleotide comprising a repeat tract within an intron 1 of a zinc finger protein 9 (ZNF9) genomic sequence, the method comprising: amplifying nucleotides of an intron 1 region of a ZNF9 genomic sequence to form amplified polynucleotides, wherein the amplified polynucleotides comprise repeat tracts; and detecting the amplified polynucleotides. 2. A method for detecting a polynucleotide comprising a repeat tract within an intron 1 of a ZNF9 genomic sequence, the method comprising: digesting genomic DNA with a restriction endonuclease to obtain polynucleotides; probing the polynucleotides under hybridizing conditions with a detectably labeled probe which hybridizes to a polynucleotide containing a repeat tract within an intron 1 of a ZNF9 genomic sequence; and detecting the probe which has hybridized to the polynucleotides. 3. A method for identifying an individual not at risk for developing myotonic dystrophy type 2 (DM2), the method comprising: analyzing intron 1 regions of ZNF9 genomic sequences of an individual for two not at risk alleles comprising repeat tracts of no greater than about 176 nucleotides, wherein an individual comprising two alleles comprising repeat tracts of no greater than about 176 nucleotides is not at risk for developing DM2. 4. A method for identifying an individual not at risk for developing DM2, the method comprising: amplifying nucleotides of intron 1 regions of ZNF9 genomic sequences of an individual to form amplified polynucleotides, wherein the amplified polynucleotides comprise repeat tracts; comparing the size of the amplified polynucleotides; and analyzing the amplified polynucleotides for two not at risk alleles wherein an individual comprising two not at risk alleles is not at risk for developing DM2. 5. The method of claim 4 wherein amplifying comprises: performing a polymerase chain reaction (PCR) with a primer pair comprising a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions, wherein the first primer comprises at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO: 1, and the second primer comprises at least about 15 nucleotides selected from nucleotides 17858-18661 of SEQ ID NO:1. 6. A method for identifying an individual not at risk for developing DM2, the method comprising: amplifying nucleotides of intron 1 regions within ZNF9 genomic sequences of an individual to form amplified polynucleotides, wherein the amplified polynucleotides comprise repeat tracts; and analyzing the repeat tracts of the amplified polynucleotides for two not at risk alleles comprising repeat tracts of no greater than about 176 nucleotides, wherein an individual comprising two alleles comprising repeat tracts of no greater than about 176 nucleotides is not at risk for developing DM2. 7. A method for identifying an individual that has DM2 or is at risk for developing DM2, the method comprising: analyzing an intron 1 region of a ZNF9 genomic sequence of an individual for one at risk allele comprising a repeat tract comprising at least about 75 CCTG repeats wherein an individual comprising one allele comnrising a repeat tract of at least about 75 CCTG repeats has DM2 or is at risk for developing DM2. 8. A method for identifying an individual that has DM2 or is at risk for developing DM2, the method comprising: digesting genomic DNA of an individual with a restriction endonuclease to obtain polynucleotides; probing the polynucleotides under hybridizing conditions with a detectably labeled probe that hybridizes to a polynucleotide containing a repeat tract within an intron 1 of a ZNF9 genomic sequence; detecting the probe that has hybridized to the polynucleotide; and analyzing the intron 1 region of the hybridized polynucleotide for one at risk allele comprising a repeat tract comprising at least about 75 CCTG repeats, wherein an individual comprising one allele comprising a repeat tract of at least about 75 CCTG repeats has DM2 or is at risk for developing DM2. 9. The method of claim 8 wherein the probe comprises at least about 200 consecutive nucleotides from SEQ ID NO: 1, or the complement of the at least 200 concecutive nucleotides from SEQ ID NO:1. 10. A method for identifying an individual that has or is at risk for developing DM2, the method comprising: amplifying nucleotides of an intron 1 region of a ZNF9 genomic sequence of an individual to form amplified polynucleotides, wherein the amplified polynucleotides comprise a repeat tract; and analyzing the repeat tracts of the amplified polynucleotides for one at risk allele comprising a repeat tract comprising at least about 75 CCTG repeats, wherein an individual comprising one at risk allele comnrising a repeat tract of at least about 75 CCTG reoeats has or is at risk for develoDing DM2. 11. The method of claim 10 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer flanks the CCTG repeat tract located within the intron 1 region, the first primer comprising at least about 15 nucleotides selected from nucleotides 4469 15701-17701 of SEQ ID NQ:1 or nucleotides 17858-18661 of SEQ ID NO:1, and the second primer comprising a nucleotide sequence that hybridizes to the CCTG repeat tract. 12. The method of claim 1 wherein detecting comprises detecting amplified polynucleotides comprising a repeat tract of no greater than about 176 nucleotides. 13. The method of claim 1 wherein detecting comprises detecting amplified polynucleotides comprising a repeat tract comprising at least about 75 CCTG repeats. 14. The method of claim 1 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions, wherein the first primer comprises at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1, and the second primer comprises at least about 15 nucleotides selected from nucleotides 17858-19858 of SEQ ID NO: 1. 15. The method of claim 14 wherein the first primer comprises GGCCTTATAACCATGCAAATG (SEQ ID NO:11) and the second primer comprises GCCTAGGGGACAAAGTGAGA (SEQ ID NO:10). 16. The method of claim 1 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer flanks a CCTG repeat tract located within the intron 1 region, the first primer comprising at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1 or nucleotides 17858-18661 of SEQ ID NO:1, and the second primer comprising a nucleotide sequence that hybridizes to the CCTG repeat tract. 17. The method of claim 1 wherein amplifying comprises: performing a PCR with a first primer comprising GGCCTTTATAACCATGCAAATG (SEQ ID NO:11), a second primer comprising TACGCATCCGAGTTTGAGACGCAGGCAGGCAGGCAGGCAGG (SEQ ID NO:36), and a third primer comprising TACGCATCCGAGTTTGAGACG (SEQ ID NO:37). 18. The method of claim 1 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer flanks a CCTG repeat tract located within the intron 1 region, the first primer comprising at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1 or nucleotides 17858-19858 of SEQ ID NO:1, and the second primer comprising a nucleotide sequence that hybridizes to the CCTG repeat tract. 19. The method of claim 2 wherein the probe comprises at least about 200 consecutive nucleotides from SEQ ID NO: 1, or the complement of the at least 200 consective nucleotides from SEQ ID NO: 1. 20. The method of claim 2 wherein the probe comprises TTGGACTTGQAATGAGTGAATG (SEQ ID NO:38) or nucleotides 16507-16992 of SEQ ID NO:1. 21. The method of claim 4 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions, wherein the first primer comprises at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1, and the second primer comprises at least about 15 nucleotides selected from nucleotides 17858-19858 of SEQ ID NO:1. 22. The method of claim 21 wherein the first primer comprises GGCCTTATAACCATGCAAATG (SEQ ID NO: 11) and the second primer comprises GCCTAGGGGACAAAGTGAGA (SEQ ID NO:10). 23. The method of claim 6 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions, wherein the first primer comprises at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1, and the second primer comprises at least about 15 nucleotides selected from nucleotides 17858-19858 of SEQ ID NO:1. 24. The method of claim 23 wherein the first primer comprises GGCCTTATAACCATGCAAATG (SEQ ID NO:11) and the second primer comprises GCCTAGGGGACAAAGTGAGA (SEQ ID NO:10). 25. The method of claim 6 wherein amplifying comprises: performing a polymerase chain reaction (PCR) with a primer pair comprising a first primer and a second primer, wherein the first primer and the second primer flank the repeat tracts located within the intron 1 regions, wherein the first primer comprises at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1, and the second primer comprises at least about 15 nucleotides selected from nucleotides 17858-18661 of SEQ ID NO: 1. 26. The method of claim 8 wherein the probe comprises TTGGACTTGGAATGAGTGAATG (SEQ ID NO:38) or nucleotides 16507-16992 of SEQ ID NO:1. 27. The method of claim 10 wherein amplifying comprises: performing a PCR with a primer pair comprising a first primer and a second primer, wherein the first primer flanks the CCTG repeat tract located within the intron 1 region, the first primer comprising at least about 15 nucleotides selected from nucleotides 15701-17701 of SEQ ID NO:1 ornucleotides 17858-19858 of SEQ ID NO:1, and the second primer comprising a nucleotide sequence that hybridizes to the CCTG repeat tract. 28. The method of claim 10 wherein amplifying comprises: performing a PCR with a first primer comprising GGCCTTATAACCATGCAAATG (SEQ ID NO:11), a second primer comprises TACGCATCCGAGTTTGAGACGCAGGCAGGCAGGCAGGCAGG (SEQ ID NO:36), and a third primer comprising TACGCATCCGAGTTTGAGACG (SEQ ID NO:37). 29. A method for identifying an individual not at risk for developing DM2, the method comprising: amplifying nucleotides of intron 1 regions of ZNF9 genomic sequences of an individual to form amplified polynucleotides, wherein the amplified polynucleotides comprise repeat tracts; and comparing the size of the amplified polynucleotides, wherein the presence of two amplified polynucleotides indicates the individual is not at risk for developing DM2. 30. A method for identifying an individual that has DM2 or is at risk for developing DM2, the method comprising: providing a tissue sample from an individual; probing the tissue sample under hybridizing conditions with a detectably labeled probe which hybridizes to a polynucleotide containing a repeat tract within an intron 1 of a ZNF9 genomic sequence; detecting the probe which has hybridized to polynucleotides present in the tissue sample; and observing nuclei of cells present in the tissue sample, wherein the presence of the detectably labeled probe in nuclei of the cells indicates the individual has or is at risk for developing DM2. 31. The method of claim 30 wherein the probe comprises (CAGG).sub.n, where n is at least 4. 32. A method for identifying an individual that is not at risk for developing DM2, the method comprising: providing a tissue sample from an individual; probing the tissue sample under hybridizing conditions with a detectably labeled probe which hybridizes to a polynucleotide containing a repeat tract within an intron 1 of a ZNF9 genomic sequence; detecting the probe which has hybridized to polynucleotides present in the tissue sample; and observing nuclei of cells present in the tissue sample, wherein the absence of the detectably labeled probe in nuclei of the cells indicates the individual is not at risk for developing DM2. 33. The method of claim 32 wherein the probe comprises (CAGG).sub.n, where n is at least 4.

Details for Patent 6,902,896

Applicant	Tradename	Biologic Ingredient	Dosage Form	BLA	Approval Date	Patent No.	Expiredate
Merck Sharp & Dohme Corp.	INTRON A	interferon alfa-2b	For Injection	103132	06/04/1986		2021-05-11
Merck Sharp & Dohme Corp.	INTRON A	interferon alfa-2b	For Injection	103132			2021-05-11
Merck Sharp & Dohme Corp.	INTRON A	interferon alfa-2b	Injection	103132			2021-05-11