Claims for Patent: 7,838,657

Summary for Patent: 7,838,657

Title:	Spinal muscular atrophy (SMA) treatment via targeting of SMN2 splice site inhibitory sequences
Abstract:	The present invention is directed to methods and compositions capable of blocking the inhibitory effect of a newly-identified intronic inhibitory sequence element, named ISS-N1 (for "intronic splicing silencer"), located in the SMN2 gene. The compositions and methods of the instant invention include oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target the SMN2 ISS-N1 site in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The ISS-N1 blocking agents of the invention cause elevated expression of SMN protein, thus compensating for the loss of SMN protein expression commonly observed in subjects with spinal muscular atrophy (SMA).
Inventor(s):	Singh; Ravindra N. (Shrewsbury, MA), Singh; Natalia N. (Shrewsbury, MA), Singh; Nirmal K. (Temple, TX), Androphy; Elliot J. (Natick, MA)
Assignee:	University of Massachusetts (Boston, MA)
Application Number:	11/295,725
Patent Claims:	1. An oligonucleotide of 15 to 40 linked nucleotides or modified nucleotides in length, which oligonucleotide comprises a sequence: at least 80% complementary to intron 7 of the SMN2 gene over the entire length of the oligonucleotide; and at least 85% complementary to the sequence 5'-CCAGCAUUAUGAAAG-3' (SEQ ID NO: 3); wherein the oligonucleotide comprises at least one modified nucleotide. 2. The oligonucleotide of claim 1, which is at least 90% complementary to the sequence 5'-CCAGCAUUAUGAAAG-3' (SEQ ID NO: 3). 3. The oligonucleotide of claim 1 which is 100% complementary to the sequence 5'-CCAGCAUUAUGAAAG-3' (SEQ ID NO: 3). 4. The oligonucleotide of claim 1 comprising the sequence 5'-CUUUCAUAAUGCUGG-3' (SEQ ID NO: 4). 5. The oligonucleotide of claim 1, which oligonucleotide comprises at least one modified nucleotide which comprises a modified sugar moiety. 6. The oligonucleotide of claim 1, which oligonucleotide comprises at least one 2'-deoxy ribonucleotide. 7. The oligonucleotide of claim 6, wherein the at least one 2'-deoxy ribonucleotide is 2'-deoxy adenosine or 2'-deoxy guanosine. 8. The oligonucleotide of claim 1, wherein the oligonucleotide comprises at least one modified nucleotide comprising a modified sugar moiety which is modified at the 2'-position. 9. The oligonucleotide of claim 8, wherein the modified sugar moiety comprises a 2-substituent selected from the group consisting of: H, OR, R, halo, SH, SR, NH.sub.2, NHR, NR.sub.2, and ON, where R is a C.sub.1-C.sub.6 alkyl, alkenyl, or alkynyl and halo is F, Cl, Br or I. 10. The oligonucleotide of claim 8, wherein the modified sugar moiety comprises a 2' OCH.sub.3. 11. The oligonucleotide of claim 1, wherein the oligonucleotide comprises at least one modified nucleotide selected from the group consisting of 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine and 2'-amino-butyryl-pyrene-uridine. 12. The oligonucleotide of claim 1, wherein the oligonucleotide comprises at least one modified nucleotide selected from the group consisting of 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 5-fluoro-cytidine, and 5-fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine, and 5-amino-allyl-uridine. 13. The oligonucleotide of claim 1, wherein the oligonucleotide comprises at least one modified linkage. 14. The oligonucleotide of claim 13, wherein the at least one modified linkage is a phosphorothioate linkage. 15. The oligonucleotide of claim 13, wherein each linkage of the oligonucleotide is a phosphorothioate linkage. 16. The oligonucleotide of claim 1, wherein the modified nucleotide is a locked nucleic acid (LNA) nucleotide. 17. The oligonucleotide of claim 1, comprising at least one bicyclic nucleotide. 18. The oligonucleotide of claim 1, wherein each nucleotide of the oligonucleotide is a modified nucleotide. 19. The oligonucleotide of claim 1, wherein each nucleotide of the oligonucleotide comprises a modified sugar moiety. 20. The oligonucleotide of claim 1, wherein each nucleotide of the oligonucleotide is a modified nucleotide and each modified nucleotide comprises the same modification. 21. The oligonucleotide of claim 20, wherein each nucleotide of the oligonucleotide comprises a bicyclic nucleotide. 22. The oligonucleotide of claim 1, wherein each nucleotide of the oligonucleotide comprises a modified sugar moiety which is modified at the 2'-position. 23. The oligonucleotide of claim 22, wherein the modified sugar moiety comprises a 2' substituent selected from the group consisting of: H, OR, R, halo, SH, SR, NH.sub.2, NHR, NR.sub.2, and ON, where R is a C.sub.1-C.sub.6 alkyl, alkenyl, or alkynyl and halo is F, Cl, Br or I. 24. The oligonucleotide of claim 22, wherein each modified sugar moiety comprises a 2' OCH.sub.3. 25. The oligonucleotide of claim 1, which is 20 nucleotides or more in length. 26. A composition comprising the oligonucleotide of claim 1 and a pharmaceutically acceptable carrier. 27. An oligonucleotide of 15 to 40 nucleotides or modified nucleotides in length, wherein the oligonucleotide comprises a sequence: 100% complementary to intron 7 of the SMN2 gene over the entire length of the oligonucleotide; and 100% complementary to the sequence 5'-CCAGCAUUAUGAAAG-3' (SEQ ID NO:3), wherein the oligonucleotide comprises a at least one modified nucleotide comprising a modified sugar moiety. 28. The oligonucleotide of claim 27, which oligonucleotide comprises at least one 2'-deoxy ribonucleotide. 29. The oligonucleotide of claim 28, wherein the at least one 2'-deoxy ribonucleotide is 2'-deoxy adenosine or 2'-deoxy guanosine. 30. The oligonucleotide of claim 27, wherein the oligonucleotide comprises at least one modified nucleotide comprising a modified sugar moiety which is modified at the 2' position. 31. The oligonucleotide of claim 30, wherein the modified sugar moiety comprises a 2'-substituent selected from the group consisting of: H, OR, R, halo, SH, SR, NH.sub.2, NHR, NR.sub.2, and ON, where R is a C.sub.1-C.sub.6 alkyl, alkenyl, or alkynyl and halo is F, Cl, Br or I. 32. The oligonucleotide of claim 30, wherein the modified sugar moiety comprises a 2' OCH.sub.3. 33. The oligonucleotide of claim 27, wherein the modified nucleotide is selected from the group consisting of 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine and 2'-amino-butyryl-pyrene-uridine. 34. The oligonucleotide of claim 27, wherein the modified nucleotide is selected from the group consisting of 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 5-fluoro-cytidine, and 5-fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine, and 5-amino-allyl-uridine. 35. The oligonucleotide of claim 27, wherein the oligonucleotide comprises at least one modified linkage. 36. The oligonucleotide of claim 27, wherein the at least one modified linkage is a phosphorothioate linkage. 37. The oligonucleotide of claim 35, wherein each linkage is a phosphorothioate linkage. 38. The oligonucleotide of claim 27, which oligonucleotide comprises a locked nucleic acid (LNA) nucleotide. 39. The oligonucleotide of claim 27, comprising at least one bicyclic nucleotide. 40. The oligonucleotide of claim 27, wherein each nucleotide of the oligonucleotide is a modified nucleotide. 41. The oligonucleotide of claim 27, wherein each nucleotide of the oligonucleotide comprises a modified sugar moiety. 42. The oligonucleotide of claim 27, wherein each nucleotide of the oligonucleotide is a modified nucleotide and each modified nucleotide comprises the same modification. 43. The oligonucleotide of claim 27, wherein each nucleotide of the oligonucleotide comprises a bicyclic nucleotide. 44. The oligonucleotide of claim 27, wherein each nucleotide of the oligonucleotide comprises a modified sugar moiety modified at the 2'-position. 45. The oligonucleotide of claim 44, wherein the modified sugar moiety comprises a 2' substituent selected from the group consisting of: H, OR, R, halo, SH, SR, NH.sub.2, NHR, NR.sub.2, and ON, where R is a C.sub.1-C.sub.6 alkyl, alkenyl, or alkynyl and halo is F, Cl, Br or I. 46. The oligonucleotide of claim 44, wherein each modified sugar moiety comprises a 2' OCH.sub.3. 47. The oligonucleotide of claim 27, which is 20 nucleotides or more in length. 48. A composition comprising the oligonucleotide of claim 27 and a pharmaceutically acceptable carrier. 49. The oligonucleotide of claim 1, which comprises the complement of the nucleotide sequence CCAGCAUUAUGAAAGUGAAU, set forth as nucleotides 10-29 of SEQ ID NO:103. 50. The oligonucleotide of claim 48, which consists of the complement of the nucleotide sequence CCAGCAUUAUGAAAGUGAAU, set forth as nucleotides 10-29 of SEQ ID NO:103.