Last Updated: August 12, 2026

Claims for Patent: 7,838,657


✉ Email this page to a colleague

« Back to Dashboard


Summary for Patent: 7,838,657
Title:Spinal muscular atrophy (SMA) treatment via targeting of SMN2 splice site inhibitory sequences
Abstract:The present invention is directed to methods and compositions capable of blocking the inhibitory effect of a newly-identified intronic inhibitory sequence element, named ISS-N1 (for “intronic splicing silencer”), located in the SMN2 gene. The compositions and methods of the instant invention include oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target the SMN2 ISS-N1 site in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The ISS-N1 blocking agents of the invention cause elevated expression of SMN protein, thus compensating for the loss of SMN protein expression commonly observed in subjects with spinal muscular atrophy (SMA).
Inventor(s):Ravindra N. Singh, Natalia N. Singh, Nirmal K. Singh, Elliot J. Androphy
Assignee: University of Massachusetts Boston , University of Massachusetts Amherst
Application Number:US11/295,725
Patent Claims: 1. An oligonucleotide of 15 to 40 linked nucleotides or modified nucleotides in length, which oligonucleotide comprises a sequence: at least 80% complementary to intron 7 of the SMN2 gene over the entire length of the oligonucleotide; and at least 85% complementary to the sequence 5′-CCAGCAUUAUGAAAG-3′ (SEQ ID NO: 3); wherein the oligonucleotide comprises at least one modified nucleotide.

2. The oligonucleotide of claim 1, which is at least 90% complementary to the sequence 5′-CCAGCAUUAUGAAAG-3′ (SEQ ID NO: 3).

3. The oligonucleotide of claim 1 which is 100% complementary to the sequence 5′-CCAGCAUUAUGAAAG-3′ (SEQ ID NO: 3).

4. The oligonucleotide of claim 1 comprising the sequence 5′-CUUUCAUAAUGCUGG-3′ (SEQ ID NO: 4).

5. The oligonucleotide of claim 1, which oligonucleotide comprises at least one modified nucleotide which comprises a modified sugar moiety.

6. The oligonucleotide of claim 1, which oligonucleotide comprises at least one 2′-deoxy ribonucleotide.

7. The oligonucleotide of claim 6, wherein the at least one 2′-deoxy ribonucleotide is 2′-deoxy adenosine or 2′-deoxy guanosine.

8. The oligonucleotide of claim 1, wherein the oligonucleotide comprises at least one modified nucleotide comprising a modified sugar moiety which is modified at the 2′-position.

9. The oligonucleotide of claim 8, wherein the modified sugar moiety comprises a 2-substituent selected from the group consisting of: H, OR, R, halo, SH, SR, NH2, NHR, NR2, and ON, where R is a C1-C6 alkyl, alkenyl, or alkynyl and halo is F, Cl, Br or I.

10. The oligonucleotide of claim 8, wherein the modified sugar moiety comprises a 2′ OCH3.

11. The oligonucleotide of claim 1, wherein the oligonucleotide comprises at least one modified nucleotide selected from the group consisting of 2′-fluoro-cytidine, 2′-fluoro-uridine, 2′-fluoro-adenosine, 2′-fluoro-guanosine, 2′-amino-cytidine, 2′-amino-uridine, 2′-amino-adenosine, 2′-amino-guanosine and 2′-amino-butyryl-pyrene-uridine.

12. The oligonucleotide of claim 1, wherein the oligonucleotide comprises at least one modified nucleotide selected from the group consisting of 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 5-fluoro-cytidine, and 5-fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine, and 5-amino-allyl-uridine.

13. The oligonucleotide of claim 1, wherein the oligonucleotide comprises at least one modified linkage.

14. The oligonucleotide of claim 13, wherein the at least one modified linkage is a phosphorothioate linkage.

15. The oligonucleotide of claim 13, wherein each linkage of the oligonucleotide is a phosphorothioate linkage.

16. The oligonucleotide of claim 1, wherein the modified nucleotide is a locked nucleic acid (LNA) nucleotide.

17. The oligonucleotide of claim 1, comprising at least one bicyclic nucleotide.

18. The oligonucleotide of claim 1, wherein each nucleotide of the oligonucleotide is a modified nucleotide.

19. The oligonucleotide of claim 1, wherein each nucleotide of the oligonucleotide comprises a modified sugar moiety.

20. The oligonucleotide of claim 1, wherein each nucleotide of the oligonucleotide is a modified nucleotide and each modified nucleotide comprises the same modification.

21. The oligonucleotide of claim 20, wherein each nucleotide of the oligonucleotide comprises a bicyclic nucleotide.

22. The oligonucleotide of claim 1, wherein each nucleotide of the oligonucleotide comprises a modified sugar moiety which is modified at the 2′-position.

23. The oligonucleotide of claim 22, wherein the modified sugar moiety comprises a 2′ substituent selected from the group consisting of: H, OR, R, halo, SH, SR, NH2, NHR, NR2, and ON, where R is a C1-C6 alkyl, alkenyl, or alkynyl and halo is F, Cl, Br or I.

24. The oligonucleotide of claim 22, wherein each modified sugar moiety comprises a 2′ OCH3.

25. The oligonucleotide of claim 1, which is 20 nucleotides or more in length.

26. A composition comprising the oligonucleotide of claim 1 and a pharmaceutically acceptable carrier.

27. An oligonucleotide of 15 to 40 nucleotides or modified nucleotides in length, wherein the oligonucleotide comprises a sequence: 100% complementary to intron 7 of the SMN2 gene over the entire length of the oligonucleotide; and 100% complementary to the sequence 5′-CCAGCAUUAUGAAAG-3′ (SEQ ID NO:3), wherein the oligonucleotide comprises a at least one modified nucleotide comprising a modified sugar moiety.

28. The oligonucleotide of claim 27, which oligonucleotide comprises at least one 2′-deoxy ribonucleotide.

29. The oligonucleotide of claim 28, wherein the at least one 2′-deoxy ribonucleotide is 2′-deoxy adenosine or 2′-deoxy guanosine.

30. The oligonucleotide of claim 27, wherein the oligonucleotide comprises at least one modified nucleotide comprising a modified sugar moiety which is modified at the 2′ position.

31. The oligonucleotide of claim 30, wherein the modified sugar moiety comprises a 2′-substituent selected from the group consisting of: H, OR, R, halo, SH, SR, NH2, NHR, NR2, and ON, where R is a C1-C6 alkyl, alkenyl, or alkynyl and halo is F, Cl, Br or I.

32. The oligonucleotide of claim 30, wherein the modified sugar moiety comprises a 2′ OCH3.

33. The oligonucleotide of claim 27, wherein the modified nucleotide is selected from the group consisting of 2′-fluoro-cytidine, 2′-fluoro-uridine, 2′-fluoro-adenosine, 2′-fluoro-guanosine, 2′-amino-cytidine, 2′-amino-uridine, 2′-amino-adenosine, 2′-amino-guanosine and 2′-amino-butyryl-pyrene-uridine.

34. The oligonucleotide of claim 27, wherein the modified nucleotide is selected from the group consisting of 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 5-fluoro-cytidine, and 5-fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine, and 5-amino-allyl-uridine.

35. The oligonucleotide of claim 27, wherein the oligonucleotide comprises at least one modified linkage.

36. The oligonucleotide of claim 27, wherein the at least one modified linkage is a phosphorothioate linkage.

37. The oligonucleotide of claim 35, wherein each linkage is a phosphorothioate linkage.

38. The oligonucleotide of claim 27, which oligonucleotide comprises a locked nucleic acid (LNA) nucleotide.

39. The oligonucleotide of claim 27, comprising at least one bicyclic nucleotide.

40. The oligonucleotide of claim 27, wherein each nucleotide of the oligonucleotide is a modified nucleotide.

41. The oligonucleotide of claim 27, wherein each nucleotide of the oligonucleotide comprises a modified sugar moiety.

42. The oligonucleotide of claim 27, wherein each nucleotide of the oligonucleotide is a modified nucleotide and each modified nucleotide comprises the same modification.

43. The oligonucleotide of claim 27, wherein each nucleotide of the oligonucleotide comprises a bicyclic nucleotide.

44. The oligonucleotide of claim 27, wherein each nucleotide of the oligonucleotide comprises a modified sugar moiety modified at the 2′-position.

45. The oligonucleotide of claim 44, wherein the modified sugar moiety comprises a 2′ substituent selected from the group consisting of: H, OR, R, halo, SH, SR, NH2, NHR, NR2, and ON, where R is a C1-C6 alkyl, alkenyl, or alkynyl and halo is F, Cl, Br or I.

46. The oligonucleotide of claim 44, wherein each modified sugar moiety comprises a 2′ OCH3.

47. The oligonucleotide of claim 27, which is 20 nucleotides or more in length.

48. A composition comprising the oligonucleotide of claim 27 and a pharmaceutically acceptable carrier.

49. The oligonucleotide of claim 1, which comprises the complement of the nucleotide sequence CCAGCAUUAUGAAAGUGAAU, set forth as nucleotides 10-29 of SEQ ID NO:103.

50. The oligonucleotide of claim 48, which consists of the complement of the nucleotide sequence CCAGCAUUAUGAAAGUGAAU, set forth as nucleotides 10-29 of SEQ ID NO:103.

Make Better Decisions: Try a trial or see plans & pricing

Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. We do not provide individual investment advice. This service is not registered with any financial regulatory agency. The information we publish is educational only and based on our opinions plus our models. By using DrugPatentWatch you acknowledge that we do not provide personalized recommendations or advice. thinkBiotech performs no independent verification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.