Claims for Patent: 11,661,604

Summary for Patent: 11,661,604

Title:	Methods and compositions for inhibiting expression of LDHA
Abstract:	This disclosure relates to oligonucleotides, compositions and methods useful for reducing LDHA expression, particularly in hepatocytes.
Inventor(s):	Bob D. Brown, Henryk T. Dudek, Utsav SAXENA, Natalie PURSELL, Cheng Lai, Weimin Wang, Rachel STORR, Naim Nazef, Boyoung Kim
Assignee:	Novo Nordisk Health Care AG
Application Number:	US17/022,696
Patent Claims:	1. An oligonucleotide for reducing expression of Lactate dehydrogenase A (LDHA), the oligonucleotide comprising an antisense strand having a sequence set forth as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1) and a sense strand having a sequence set forth as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 2), wherein one or more of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety through an acetal linker, and wherein the nucleotides of the oligonucleotide are modified, wherein all of positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are modified with a 2′-O-methyl, and wherein all of positions 3, 5, 8-11, 13, 15, or 17 of the sense strand and positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are modified with a 2′-fluoro. 2. The oligonucleotide of claim 1, wherein each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety. 3. The oligonucleotide of claim 1, wherein the oligonucleotide has a phosphorothioate linkage between each of: positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. 4. The oligonucleotide of claim 1, wherein the antisense strand comprises a 4′-oxymethylphosphonate at a 5′-terminal nucleotide. 5. An oligonucleotide for reducing expression of Lactate dehydrogenase A (LDHA), the oligonucleotide comprising an antisense strand having a sequence set forth as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1) and a sense strand having a sequence set forth as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 2), wherein one or more of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety through an acetal linker, wherein the nucleotides of the oligonucleotide are modified with a 2′-O-methyl or a 2′-fluoro, wherein at least one internucleotide linkage is modified as a phosphorothioate linkage, and wherein the antisense strand comprises a 4′-phosphate analog at a 5′-terminal nucleotide, and wherein all of positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are modified with a 2′-O-methyl, and wherein all of positions 3, 5, 8-11, 13, 15, or 17 of the sense strand and positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are modified with a 2′-fluoro. 6. The oligonucleotide of claim 5, wherein each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety. 7. The oligonucleotide of claim 5, wherein the antisense strand comprises a 4′-oxymethylphosphonate at a 5′-terminal nucleotide. 8. The oligonucleotide of claim 5, wherein the oligonucleotide has a phosphorothioate linkage between each of: positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. 9. An oligonucleotide for reducing expression of Lactate dehydrogenase A (LDHA) having the structure as shown in FIG. 1A, wherein the -GAAA- sequence at positions 27-30 of the sense strand has the structure: and the nucleotide at position 1 of the antisense strand has the structure: 10. The oligonucleotide of claim 9, wherein the oligonucleotide has the structure: 11. A composition comprising the oligonucleotide of claim 1 and Na+ counterions. 12. A method of reducing expression of Lactate dehydrogenase A (LDHA) in a subject, the method comprising administering the composition of claim 11 to the subject. 13. The method of claim 12, wherein the subject has or is at risk of having PH1, PH2, PH3, and/or idiopathic hyperoxaluria. 14. The method of claim 13, wherein the composition is administered to the subject intravenously or subcutaneously. 15. A composition comprising the oligonucleotide of claim 9 and Na+ counterions. 16. A method of reducing expression of Lactate dehydrogenase A (LDHA) in a subject, the method comprising administering the composition of claim 15 to the subject. 17. The method of claim 16, wherein the subject has or is at risk of having PH1, PH2, PH3, and/or idiopathic hyperoxaluria. 18. A composition comprising the oligonucleotide of claim 5 and Na+ counterions. 19. A method of reducing expression of Lactate dehydrogenase A (LDHA) in a subject, the method comprising administering the composition of claim 18 to the subject. 20. The method of claim 19, wherein the subject has or is at risk of having PH1, PH2, PH3, and/or idiopathic hyperoxaluria.