You're using a free limited version of DrugPatentWatch: Upgrade for Complete Access

Last Updated: March 26, 2026

Claims for Patent: 11,286,488


✉ Email this page to a colleague

« Back to Dashboard


Summary for Patent: 11,286,488
Title:Methods and compositions for inhibiting expression of LDHA
Abstract:This disclosure relates to oligonucleotides, compositions and methods useful for reducing LDHA expression, particularly in hepatocytes.
Inventor(s):Bob D. Brown, Henryk T. Dudek, Utsav SAXENA, Natalie PURSELL, Cheng Lai, Weimin Wang, Rachel STORR, Naim Nazef, Boyoung Kim
Assignee: Novo Nordisk Health Care AG
Application Number:US16/755,342
Patent Claims: 1. An oligonucleotide for reducing expression of Lactate dehydrogenase A (LDHA), the oligonucleotide comprising an antisense strand having a sequence set forth as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1) and a sense strand having a sequence set forth as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 2), wherein all of positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are modified with a 2′-O-methyl, and all of positions 3, 5, 8-11, 13, 15, and 17 of the sense strand and positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are modified with a 2′-fluoro; wherein the oligonucleotide has a phosphorothioate linkage between each of: positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand; wherein the oligonucleotide comprises the following structure at position 1 of the antisense strand: wherein each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety comprising the structure:

2. A composition comprising the oligonucleotide of claim 1, and an excipient.

3. The composition of claim 2, further comprising Na+ counterions.

4. A method for treating a subject having or at risk of having a primary hyperoxaluria, comprising administering the composition of claim 2 to the subject.

5. The composition of claim 2, wherein the excipient comprises phosphate-buffered saline.

6. The method of claim 4, wherein the composition is administered intravenously.

7. The method of claim 4, wherein the composition is administered subcutaneously.

8. The method of claim 4, wherein the excipient in the composition comprises phosphate-buffered saline.

9. The method of claim 4, wherein the primary hyperoxaluria is selected from PH1, PH2, PH3, and idiopathic hyperoxaluria.

10. A method for reducing hepatic oxalate production in a subject, comprising administering the composition of claim 2 to the subject.

11. The method of claim 10, wherein the composition is administered intravenously.

12. The method of claim 10, wherein the composition is administered subcutaneously.

13. The method of claim 10, wherein the excipient in the composition comprises phosphate-buffered saline.

14. An oligonucleotide for reducing expression of Lactate dehydrogenase A (LDHA), having the following formula:

15. A composition comprising the oligonucleotide of claim 14, and an excipient.

16. The composition of claim 15, wherein the excipient comprises phosphate-buffered saline.

17. A method for treating a subject having or at risk of having a primary hyperoxaluria, comprising administering the composition of claim 15 to the subject.

18. The method of claim 17, wherein the composition is administered intravenously.

19. The method of claim 17, wherein the composition is administered subcutaneously.

20. The method of claim 17, wherein the excipient in the composition comprises phosphate-buffered saline.

21. The method of claim 17, wherein the primary hyperoxaluria is selected from PH1, PH2, PH3, and idiopathic hyperoxaluria.

22. A method for reducing hepatic oxalate production in a subject, comprising administering the composition of claim 15 to the subject.

23. The method of claim 22, wherein the composition is administered intravenously.

24. The method of claim 22, wherein the composition is administered subcutaneously.

25. The method of claim 22, wherein the excipient in the composition comprises phosphate-buffered saline.

Make Better Decisions: Try a trial or see plans & pricing

Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. We do not provide individual investment advice. This service is not registered with any financial regulatory agency. The information we publish is educational only and based on our opinions plus our models. By using DrugPatentWatch you acknowledge that we do not provide personalized recommendations or advice. thinkBiotech performs no independent verification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.