Last Updated: September 24, 2026

Claims for Patent: 11,214,801


✉ Email this page to a colleague

« Back to Dashboard


Summary for Patent: 11,214,801
Title:RNAi agents and compositions for inhibiting expression of apolipoprotein C-III (APOC3)
Abstract:The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting Apolipoprotein C-III (also called APOC3, apoC-III, APOC-III, and APO C-III) gene expression, and compositions that include APOC3 RNAi agents. The APOC3 RNAi agents disclosed herein may be conjugated to targeting ligands, including ligands that include N-acetyl-galactosamine, to facilitate the delivery to cells, including to hepatocytes. Pharmaceutical compositions that include one or more APOC3 RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the APOC3 RNAi agents in vivo provides for inhibition of APOC3 gene expression, and can result in lower triglycerides and/or cholesterol levels in the subject. The APOC3 RNAi agents can be used in methods of treatment of APOC3-related diseases and disorders, including hypertriglyceridemia, cardiovascular disease, and other metabolic-related disorders and diseases.
Inventor(s):Zhen Li, Rui Zhu, Tao Pei, Steven Kanner, So Wong
Assignee: Arrowhead Pharmaceuticals Inc
Application Number:US16/778,188
Patent Claims: 1. An RNAi agent for inhibiting expression of an APOC3 gene, comprising: an antisense strand, wherein nucleotides 1-21 (5′→3′) of the antisense strand comprise the nucleotides of (SEQ ID NO: 3) (i) UCACUGAGAAUACUGUCCCUC; (SEQ ID NO: 5) (ii) UCACUGAGAAUACUGUCCCGU; (SEQ ID NO: 710) (iii) UCACUGAGAAUACUGUCCCUG; or (SEQ ID NO: 711) (iv) UCACUGAGAAUACUGUCCCCU; and a sense strand comprising a nucleotide sequence that is partially complementary, substantially complementary, or fully complementary to the antisense strand.

2. The RNAi agent of claim 1, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage.

3. The RNAi agent of claim 2, wherein the modified nucleotide is selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2′-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate deoxyribonucleotide, cyclopropyl phosphonate deoxyribonucleotide, and 3′-O-methyl nucleotide.

4. The RNAi agent of claim 1, wherein all or substantially all of the nucleotides of the sense and/or antisense strand of the RNAi agent are modified nucleotides.

5. The RNAi agent of claim 4, wherein all or substantially all of the modified nucleotides are either 2′-O-methyl nucleotides or 2′-fluoro nucleotides.

6. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences of SEQ ID NOs: 2, 6, 394, 401, 402, 403, 404, 405, and 406 and the sense strand comprises the nucleotide sequence of any one of the modified sequences of SEQ ID NOs: 482, 488, 500, 501, 502, 530, 543, 551, 556, 557, 572, 573, 574, 575, and 576.

7. The RNAi agent of claim 1, wherein the RNAi agent is linked to a targeting ligand.

8. The RNAi agent of claim 7, wherein the targeting ligand comprises N-acetyl-galactosamine.

9. The RNAi agent of claim 7, wherein the targeting ligand comprises a structure selected from the group consisting of: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

10. The RNAi agent of claim 9, wherein the targeting ligand comprises the structure of (NAG37) or (NAG37)s.

11. The RNAi agent of claim 7, wherein the targeting ligand is conjugated to the sense strand.

12. The RNAi agent of claim 11, wherein the targeting ligand is conjugated to the 5′ terminal end of the sense strand.

13. A composition comprising the RNAi agent of claim 1, wherein the composition comprises a pharmaceutically acceptable excipient.

14. The composition of claim 13, wherein the RNAi agent is conjugated to a targeting ligand.

15. The composition of claim 14, wherein the targeting ligand comprises N-acetyl-galactosamine.

16. The composition of claim 13, wherein the composition further comprises a second RNAi agent for inhibiting the expression of APOC3.

17. The composition of claim 13, wherein the composition further comprises one or more additional therapeutics.

18. A method for inhibiting expression of an APOC3 gene in a cell, the method comprising introducing into a cell an effective amount of the composition of claim 13.

19. The method of claim 18, wherein the cell is within a subject.

20. The method of claim 19, wherein the subject is a human subject.

21. The method of claim 18, wherein the APOC3 gene expression is inhibited by at least about 30%.

22. A method of treating an APOC3-related disease or disorder, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of claim 13.

23. The method of claim 22, wherein the disease is a cardiometabolic disease.

24. The method of claim 23, wherein the disease is hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and/or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia induced pancreatitis, metabolic syndrome, type II diabetes mellitus, familial chylomicronemia syndrome, or familial partial lipodystrophy.

25. The method of claim 22, wherein the RNAi agent is administered at a dose of about 0.05 mg/kg to about 5.0 mg/kg of body weight of the human subject.

26. The method of claim 25, wherein the dose is administered by subcutaneous injection.

27. The method of claim 22, wherein the RNAi agent is administered in two or more doses.

28. A method of lowering triglyceride levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 13.

29. A method of lowering cholesterol levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 13.

30. A method of lowering low density lipoprotein (LDL) levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 13.

Make Better Decisions: Try a trial or see plans & pricing

Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. We do not provide individual investment advice. This service is not registered with any financial regulatory agency. The information we publish is educational only and based on our opinions plus our models. By using DrugPatentWatch you acknowledge that we do not provide personalized recommendations or advice. thinkBiotech performs no independent verification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.