You’re using a public version of DrugPatentWatch with 5 free searches available | Register to unlock more free searches. CREATE FREE ACCOUNT

Last Updated: May 7, 2024

Details for Patent: 5,693,761


✉ Email this page to a colleague

« Back to Dashboard


Title: Polynucleotides encoding improved humanized immunoglobulins
Abstract:Novel methods for producing, and compositions of, humanized immunoglobulins having one or more complementarity determining regions (CDR's) and possible additional amino acids from a donor immunoglobulin and a framework region from an accepting human immunoglobulin are provided. Each humanized immunoglobulin chain will usually comprise, in addition to the CDR's, amino acids from the donor immunoglobulin framework that are, e.g., capable of interacting with the CDR's to effect binding affinity, such as one or more amino acids which are immediately adjacent to a CDR in the donor immunoglobulin or those within about about 3 .ANG. as predicted by molecular modeling. The heavy and light chains may each be designed by using any one or all of various position criteria. When combined into an intact antibody, the humanized immunoglobulins of the present invention will be substantially non-immunogenic in humans and retain substantially the same affinity as the donor immunoglobulin to the antigen, such as a protein or other compound containing an epitope.
Inventor(s): Queen; Cary L. (Los Altos, CA), Schneider; William P. (Mountain View, CA), Selick; Harold E. (Belmont, CA)
Assignee: Protein Design Labs, Inc. (Mountain View, CA)
Filing Date:Jun 07, 1995
Application Number:08/474,040
Claims:1. First and second polynucleotides respectively encoding heavy and light chain variable regions of a humanized immunoglobulin having complementarity determining regions (CDRs) from a donor immunoglobulin and heavy and light chain variable region frameworks from human acceptor immunoglobulin heavy and light chain frameworks, which humanized immunoglobulin specifically binds to an antigen with an affinity constant of at least about 10.sup.8 M.sup.-1 and no greater than about four-fold that of the donor immunoglobulin, wherein the sequence of the humanized immunoglobulin heavy chain variable region framework is at least 65% identical to the sequence of the donor immunoglobulin heavy chain variable region framework and comprises at least 70 amino acid residues identical to those in the acceptor human immunoglobulin heavy chain variable region framework.

2. First and second polynucleotides according to claim 1, wherein the humanized immunoglobulin binds to the antigen with an affinity constant no greater than about two-fold that of the donor immunoglobulin.

3. First and second polynucleotides according to claim 1, wherein the antigen is an interleukin-2 receptor or CD33 antigen.

4. First and second polynucleotides according to claim 1, wherein the donor immunoglobulin is the anti-Tac antibody or the M195 antibody.

5. First and second polynucleotides according to claim 1 wherein the acceptor immunoglobulin heavy and light chain frameworks are from the Eu human antibody.

6. A vector comprising first and second polynucleotides according to claim 1.

7. First and second polynucleotides respectively encoding heavy and light chain variable regions of a humanized immunoglobulin having complementarity determining regions (CDRs) from a donor immunoglobulin and heavy and light chain variable region frameworks from acceptor immunoglobulin heavy and light chain frameworks, which humanized immunoglobulin specifically binds to an antigen with an affinity constant of at least about 10.sup.8 M.sup.-1 and no greater than about four-fold that of the donor immunoglobulin, wherein the sequence of the acceptor immunoglobulin heavy chain variable region framework is a consensus sequence of human immunoglobulin heavy chain variable region frameworks.

8. First and second polynucleotides according to claim 1 or 7 which are operably linked to promoters.

9. A vector comprising first and second polynucleotides according to claim 7.

10. First and second polynucleotides respectively encoding heavy and light chain variable regions of a humanized immunoglobulin having complementarity determining regions (CDRs) from a donor immunoglobulin and heavy and light chain variable region frameworks from human acceptor immunoglobulin heavy and light chains, which humanized immunoglobulin specifically binds to an antigen with an affinity constant of at least about 10.sup.8 M.sup.-1 and no greater than about four-fold that of the donor immunoglobulin, wherein said humanized immunoglobulin heavy chain comprises one or more amino acids from the donor immunoglobulin heavy chain framework outside the Kabat and Chothia CDRs, wherein the donor amino acids substitute for corresponding amino acids in the acceptor immunoglobulin heavy chain framework, and each of these said donor amino acids:

(I) is adjacent to a CDR in the donor immunoglobulin sequence, or

(II) contains an atom within a distance of 6 .ANG. of a CDR in said humanized immunoglobulin.

11. First and second polynucleotides respectively encoding heavy and light chain variable regions of a humanized immunoglobulin having complementarity determining regions (CDRs) from a donor immunoglobulin and heavy and light chain variable region frameworks from human acceptor immunoglobulin heavy and light chains, which humanized immunoglobulin specifically binds to an antigen with an affinity constant of a least about 10.sup.8 M.sup.-1 and no greater than about four-fold that of the donor immunoglobulin, wherein said humanized immunoglobulin heavy chain comprises one or more amino acids from the donor immunoglobulin heavy chain framework outside the Kabat and Chothia CDRs that substitute for the corresponding amino acids in the acceptor immunoglobulin heavy chain framework, wherein each of these said donor amino acids:

(I) is adjacent to a CDR in the donor immunoglobulin sequence, or

(II) is capable of interacting with amino acids in the CDRs, or

(III) is typical at its position for human immunoglobulin sequences, and the substituted amino acid in the acceptor is rare at its position for human immunoglobulin sequences.

12. First and second polynucleotides according to claim 10 or 11 which are operably linked to promoters.

13. First and second polynucleotides according to claim 10 or 11, wherein the antigen is a human interleukin-2 receptor or CD33 antigen.

14. First and second polynucleotides according to claim 10 or 11, wherein the donor immunoglobulin is the anti-Tac antibody or the M195 antibody.

15. A vector comprising first and second polynucleotides according to claim 10.

16. A vector comprising first and second polynucleotides according to claim 11.

17. A cell line transfected with a vector according to claim 6, 9, 15, or 16.

18. A cell line comprising first and second polynucleotides according to any one of claims 1, 7 10, or 11, which polynucleotides are expressed to produce the humanized immunoglobulin.

19. A method of producing an immunoglobulin comprising expressing first and second polynucleotides according to claim 10 or 11 in a cell.

20. First and second polynucleotides according to claim 10, wherein the second polynucleotide encodes a mature light chain variable region of the humanized immunoglobulin having the sequence:

D I Q M T Q S P S T L S A S V G D R Y T I T C S A S S S I S Y M H W Y Q Q K P G K A P K L L I Y T T S N L A S G V P A R F S G S G S G T E F T L T I S S L Q P D D F A T Y Y C H Q R S T Y P L T F G Q G T K V E V K.

21.

21. First and second polynucleotides according to claim 20, wherein the second polynucleotide has the sequence:

GATATTCAGATGACCCAGTCTCCATCTACCCTCTCTGCTAGCGTCGGGGATAGGG TCACCATAACCTGCTCTGCCAGCTCAAGTATAAGTTACATGCACTGGTACCAGCAGAAGC CAGGCAAAGCTCCCAAGCTTCTAATTTATACCACATCCAACCTGGCTTCTGGAGTCCCTG CTCGCTTCAGTGGCAGTGGATCTGGGACCGAGTTCACCCTCACAATCAGCTCTCTGCAGC CAGATGATTTCGCCACTTATTACTGCCATCAAAGGAGTACTTACCCACTCACGTTCGGTC AGGGGACCAAGGTGGAGGTCAAA.

22. First and second polynucleotides according to claim 10, wherein the first polynucleotide encodes a mature heavy chain variable region of the humanized immunoglobulin having the sequence:

Q V Q L V Q S G A E V K K P G S S V K V S C K A S G Y T F T S Y R M H W V R Q A P G Q G L E W I G Y I N P S T G Y T E Y N Q K F K D K A T I T A D E S T N T A Y M E L S S L R S E D T A V Y Y C A R G G G V F D Y W G Q G T L V T V S S.

23. First and second polynucleotides according to claim 22, wherein the first polynucleotide has the sequence:

CAGGTCCAGCTTGTCCAGTCTGGGGCTGAAGTCAAGAAACCTGGCTCGAGCGTGAAGGTCTCCTG CAAGGCTTCTGGCTACACCTTTACTAGCTACAGGATGCACTGGGTAAGGCAGGCCCCTGGACAGG GTCTGGAATGGATTGGATATATTAATCCGTCGACTGGGTATACTGAATACAATCAGAAGTTCAAG GACAAGGCAACAATTACTGCAGACGAATCCACCAATACAGCCTACATGGAACTGAGCAGCCTGAG ATCTGAGGACACCGCAGTCTATTACTGTGCAAGAGGGGGGGGGGTCTTTGACTACTGGGGCCAAG GAACCCTGGTCACAGTCTCCTCA.

24. First and second polynucleotides according to claim 10, wherein the second polynucleotide encodes a mature light chain variable region of the humanized immunoglobulin having the sequence:

D I Q M T Q S P S S L S A S V G D R V T I T C R A S E S V D N Y G I S F M N W F Q Q K P G K A P K L L I Y A A S N Q G S G V P S R F S G S G S G T D F T L T I S S L Q P D D F A T Y Y C Q Q S K E V P W T F G Q G T K V E I K.

25. First and second polynucleotides according to claim 10, wherein the first polynucleotide encodes a mature heavy chain variable region of the humanized immunoglobulin having the sequence:

Q V Q L V Q S G A E V K K P G S S V K V S C K A S G Y T F T D Y N M H W V R Q A P G Q G L E W I G Y I Y P Y N G G T G Y N Q K F K S K A T I T A D E S T N T A Y M E L S S L R S E D T A V Y Y C A R G R P A M D Y W G Q G T L V T V S S.

26. First and second polynucleotides according to any one of claims 1, 7 or 10, wherein the sequence of the humanized immunoglobulin light chain variable region framework is at least 65% identical to the sequence of the donor immunoglobulin light chain variable region framework and comprises at least 70 amino acid residues identical to those in the acceptor human

immunoglobulin light chain variable region framework. 27. First and second polynucleotides according to any one of claims 1, 7 or 10, wherein the sequence of the acceptor immunoglobulin light chain variable region framework is a consensus sequence of human immunoglobulin light chain

variable region frameworks. 28. First and second polynucleotides according to any one of claims 1, 7 or 10, wherein the humanized light chain comprises one or more amino acids from the donor immunoglobulin light chain framework outside the Kabat and Chothia CDRs, wherein the donor amino acids substitute for corresponding amino acids in the acceptor immunoglobulin light chain framework, and each of said donor amino acids:

(I) is adjacent to a CDR in the donor immunoglobulin sequence, or

(II) contains an atom within a distance of 6 .ANG. of a CDR in said

humanized immunoglobulin. 29. First and second polynucleotides according to claim 10, wherein each of said donor amino acids:

(I) is adjacent to a CDR in the donor immunoglobulin sequence, or

(II) contains an atom within a distance of 5 .ANG. of a CDR in said

humanized immunoglobulin. 30. First and second polynucleotides according to claim 10, wherein each of said donor amino acids:

(I) is adjacent to a CDR in the donor immunoglobulin sequence, or

(II) contains an atom within a distance of 4 .ANG. of a CDR in said

humanized immunoglobulin. 31. First and second polynucleotides according to claim 1 or 7, wherein the heavy chain of the humanized immunoglobulin comprises one or more amino acids from the donor immunoglobulin heavy chain framework outside the Kabat and Chothia CDRs, wherein the donor amino acids substitute for corresponding amino acids in the acceptor immunoglobulin heavy chain framework, and each of these said donor amino acids:

(I) is adjacent to a CDR in the donor immunoglobulin sequence, or

(II) contains an atom within a distance of 6 .ANG. of a CDR in said

humanized immunoglobulin. 32. First and second polynucleotides according to claim 1 or 7, wherein said humanized immunoglobulin heavy chain further comprises an amino acid from the donor immunoglobulin heavy chain framework outside the Kabat and Chothia CDRs that substitutes for the corresponding amino acid in the acceptor immunoglobulin heavy chain framework, wherein said amino acid is typical for its position in human immunoglobulin sequences and said corresponding amino acid in the acceptor immunoglobulin is rare for its position in human immunoglobulin sequences.

3. First and second polynucleotides according to any one of claims 1, 7, 10 or 11, wherein the polynucleotides are contained within an expression

vector. 34. First and second polynucleotides according to any one of claims 1, 7, 10, or 11, wherein the first polynucleotide and the second

polynucleotide are contained in separate vectors. 35. First and second polynucleotides respectively encoding heavy and light chain variable regions of a humanized immunoglobulin having complementarity determining regions (CDRs) from a donor immunoglobulin and heavy and light chain variable region frameworks from human acceptor immunoglobulin heavy and light chain frameworks, which humanized immunoglobulin specifically binds to an antigen with an affinity constant within about four-fold of that of the donor immunoglobulin, wherein the sequence of the humanized immunoglobulin heavy chain variable region framework is at least 65% identical to the sequence of the donor immunoglobulin heavy chain variable region framework and comprises at least 70 amino acid residues identical to those in the acceptor human immunoglobulin heavy chain variable region

framework. 36. First and second polynucleotides respectively encoding heavy and light chain variable regions of a humanized immunoglobulin having complementarity determining regions (CDRs) from a donor immunoglobulin and heavy and light chain variable region frameworks from acceptor immunoglobulin heavy and light chain frameworks, which humanized immunoglobulin specifically binds to an antigen with an affinity constant within about four-fold of that of the donor immunoglobulin, wherein the sequence of the acceptor immunoglobulin heavy chain variable region framework is a consensus sequence of human immunoglobulin heavy chain

variable region frameworks. 37. First and second polynucleotides respectively encoding heavy and light chain variable regions of a humanized immunoglobulin having complementarity determining regions (CDRs) from a donor immunoglobulin and heavy and light chain variable region frameworks from human acceptor immunoglobulin heavy and light chains, which humanized immunoglobulin specifically binds to an antigen with an affinity constant within about four-fold of the donor immunoglobulin, wherein said humanized immunoglobulin heavy chain comprises one or more amino acids from the donor immunoglobulin heavy chain framework outside the Kabat and Chothia CDRs, wherein the donor amino acids substitute for corresponding amino acids in the acceptor immunoglobulin heavy chain framework, and each of these said donor amino acids:

(I) is adjacent to a CDR in the donor immunoglobulin sequence, or

(II) contains an atom within a distance of 6 .ANG. of a CDR in said humanized immunoglobulin.

Make Better Decisions: Try a trial or see plans & pricing

Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. thinkBiotech performs no independent verification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.