United States Patent 9,018,368: Scope, Claims, Expiration, and Dystrophin Antisense Patent Landscape

U.S. Patent No. 9,018,368 protects a highly specific PEG-linked morpholino antisense oligonucleotide directed to exon 51 of the dystrophin gene. Its independent claims require the exact 30-base sequence, morpholino chemistry, and covalent attachment to a polyethylene glycol chain. The claims do not broadly cover all exon-51-skipping oligonucleotides or unmodified eteplirsen.

The patent is commercially relevant to Duchenne muscular dystrophy programs based on exon 51 skipping, but its PEG-linkage limitation materially narrows infringement risk for eteplirsen and other non-PEG morpholino products. The patent term is tied to an earliest priority date of November 7, 2008, producing a projected ordinary expiration in November 2029, subject to any applicable patent-term adjustment or disclaimer information recorded by the USPTO.

What does U.S. Patent 9,018,368 claim?

The patent has two claims supplied for analysis.

Claim	Claimed subject matter	Key limitations
Claim 1	A 30-base antisense oligonucleotide	Exact SEQ ID NO: 181; uracil bases converted to thymine; morpholino antisense oligonucleotide; chemically linked to PEG
Claim 2	Pharmaceutical composition	The same claimed oligonucleotide plus a pharmaceutically acceptable carrier

The sequence is:

CTCCAACATCAAGGAAGATGGCATTTCTAG

The original sequence is written with RNA uracil residues:

CUCCAACAUC AAGGAAGAUG GCAUUUCUAG

The claim expressly converts uracil to thymine, making the claimed sequence a DNA-letter representation of an antisense oligomer. The sequence has 30 nucleobases.

What disease and molecular target does the sequence address?

The sequence is associated with exon 51 skipping in the human dystrophin transcript. Exon skipping can restore the dystrophin reading frame in certain DMD mutations, allowing production of a truncated dystrophin protein.

The sequence is closely associated with eteplirsen, marketed by Sarepta Therapeutics as Exondys 51. Eteplirsen is a phosphorodiamidate morpholino oligomer, commonly abbreviated PMO, designed to bind dystrophin pre-mRNA and induce exon 51 skipping. The claimed patent, however, requires chemical linkage to a polyethylene glycol chain. Eteplirsen’s approved product description does not establish that the commercial drug contains a PEG-conjugated PMO. That distinction is central to claim scope and infringement analysis. [1]

How broad is claim 1 of U.S. Patent 9,018,368?

Claim 1 is narrow and structurally defined. A potentially infringing molecule must satisfy all of the following elements:

It must be an antisense oligonucleotide.
It must contain 30 bases.
It must have the claimed sequence.
Uracil positions must be thymine bases in the claimed representation.
The oligomer must have morpholino chemistry.
The oligomer must be chemically linked to a PEG chain.

Failure to satisfy any one required element avoids literal infringement of claim 1.

Does the claim cover all exon 51-skipping oligonucleotides?

No. It does not cover every exon 51-skipping sequence, every PMO, or every antisense oligonucleotide targeting dystrophin.

The claim does not expressly cover:

A different exon 51-targeting sequence.
The same sequence using a different backbone, such as 2'-O-methyl phosphorothioate RNA.
The same morpholino sequence without PEG.
A peptide-conjugated morpholino.
A PMO directed to exon 45, exon 53, or another dystrophin exon.
A composition containing the sequence but lacking the required PEG linkage.

The exact-sequence and PEG limitations create substantial design-around opportunities.

What does “chemically linked to a polyethylene glycol chain” require?

The claim requires a chemical linkage between the morpholino antisense oligonucleotide and a PEG chain. A formulation that merely contains free PEG as an excipient would not ordinarily satisfy this limitation. The PEG must be covalently or otherwise chemically attached to the oligomer as part of the claimed molecular structure.

The claim also does not specify every PEG variable. Potentially relevant structural variables include:

PEG molecular weight.
Linear or branched PEG architecture.
Number of PEG units.
Linker chemistry.
Attachment site on the morpholino.
Cleavable or non-cleavable linker.
Mono- or multi-PEG substitution.

Because the claim uses the singular phrase “a polyethylene glycol chain,” the claim may reach a range of PEG conjugate structures, but only if the claimed oligonucleotide and chemical-linkage requirements are met.

What does claim 2 add?

Claim 2 covers a pharmaceutical composition containing the claimed PEG-linked morpholino and a pharmaceutically acceptable carrier.

The carrier limitation is conventional but legally meaningful. Claim 2 requires both:

The specific PEG-linked, 30-base morpholino sequence; and
A pharmaceutical composition containing that molecule and an acceptable carrier.

The carrier could include aqueous solution components, buffering agents, tonicity agents, stabilizers, or other conventional injectable formulation materials. The claim does not appear to require a particular concentration, route of administration, dosage, container, or therapeutic indication.

Claim 2 is therefore composition-focused, but it remains dependent on every structural limitation of the claimed oligonucleotide. A formulation of non-PEG eteplirsen would not meet claim 2 merely because it contains a pharmaceutically acceptable carrier.

When does U.S. Patent 9,018,368 expire?

Event	Date or status
Earliest priority date	November 7, 2008
U.S. patent grant	April 28, 2015
Ordinary 20-year term endpoint	November 7, 2029
Expected ordinary expiration	November 2029
Patent-term adjustment	Must be confirmed from the USPTO patent record
Patent-term extension under Hatch-Waxman	No conclusion follows from the supplied claims alone

U.S. patent term generally runs 20 years from the earliest effective nonprovisional filing date, subject to patent-term adjustment, terminal disclaimers, and other statutory rules. [2] The November 2029 date is the ordinary projected endpoint based on the reported priority date. A definitive enforceability analysis must use the USPTO continuity data, maintenance-fee record, patent-term-adjustment calculation, and any terminal-disclaimer information.

Expiration would eliminate infringement liability for activities occurring after expiration, although regulatory exclusivity, trade secrets, manufacturing know-how, and separate patents could continue to affect market entry.

Is U.S. Patent 9,018,368 listed in the Orange Book for Exondys 51?

A patent’s inclusion in the FDA Orange Book depends on whether the NDA holder submits it as claiming the approved drug, a method of using the drug, or an approved drug substance or formulation under FDA listing standards. [3]

The claim language supplied here creates a material listing issue because both claims require PEG attachment. Exondys 51 is identified by FDA as eteplirsen, a PMO antisense oligonucleotide. The FDA label does not identify PEG conjugation as a defining component of the approved active ingredient. [1]

Accordingly, the patent should not be treated as automatically covering Exondys 51 merely because the sequence is associated with eteplirsen. Orange Book status must be determined from the current FDA Approved Drug Products with Therapeutic Equivalence Evaluations database and the NDA patent-submission record, not from sequence identity alone.

What is the Paragraph IV significance?

If a patent is listed for an NDA, a generic applicant filing an ANDA may submit a Paragraph IV certification alleging that the patent is invalid, unenforceable, or not infringed. [4] A Paragraph IV certification can trigger patent litigation and a potential 30-month stay of FDA approval under the Hatch-Waxman framework.

For this patent, a Paragraph IV challenge would likely focus on:

Whether the proposed product contains PEG-linked morpholino.
Whether the sequence is identical to the claimed 30-base sequence.
Whether the linkage qualifies as chemical attachment to a PEG chain.
Whether the claims are anticipated or obvious in view of prior morpholino and PEG-conjugate disclosures.
Whether prosecution-history estoppel limits equivalents to non-PEG products.
Whether the patent remains enforceable and properly listed.

A generic PMO lacking PEG would have a strong non-infringement position against the claims as written, assuming no materially different claim in the same family applies.

What is the patent landscape for dystrophin exon-skipping drugs?

The relevant landscape has several overlapping layers rather than a single sequence patent.

Layer	Typical protection	Relevance to U.S. 9,018,368
Target sequence	Specific antisense sequence	Directly required
Backbone chemistry	PMO, 2'-O-methyl RNA, phosphorothioate, or other chemistry	Directly limited to morpholino
Conjugation	PEG, peptide, antibody, or other delivery group	Directly limited to PEG
Therapeutic method	Treating DMD or inducing exon 51 skipping	Not expressly recited in supplied claims
Formulation	Injectable composition, concentration, stability, excipients	Claim 2 requires a carrier but not a specific formulation
Manufacturing	Oligomer synthesis, purification, conjugation, quality control	Not expressly recited
Regulatory exclusivity	New chemical entity, orphan-drug, or other FDA exclusivity	Separate from patent rights

How does the patent compare with eteplirsen protection?

The sequence is strongly associated with eteplirsen, but the PEG limitation creates a gap between sequence identity and product coverage.

Attribute	U.S. 9,018,368 claims	Eteplirsen as approved
Target	Dystrophin exon 51	Dystrophin exon 51
Sequence	Exact 30-base sequence	Same or closely corresponding exon-51-skipping sequence
Backbone	Morpholino	PMO
PEG attachment	Required by both supplied claims	Not identified as a component of approved eteplirsen
Pharmaceutical carrier	Required only by claim 2	Present in injectable drug product
Direct product overlap	Depends on PEG conjugation	Not established from the FDA label

The practical conclusion is that the patent has high sequence specificity but limited product breadth. Its strongest position is against a PEG-conjugated version of the exact 30-base PMO, not against every commercial or generic exon-51 PMO.

Which competing drugs create design-around or market risk?

The main competitive exon-skipping products use different sequences or target different dystrophin exons.

Product	Active ingredient	Target exon	Sponsor	Relationship to U.S. 9,018,368
Exondys 51	Eteplirsen	51	Sarepta Therapeutics	Same exon-51 therapeutic area; PEG limitation is decisive
Vyondys 53	Golodirsen	53	Sarepta Therapeutics	Different sequence and exon
Viltepso	Viltolarsen	53	NS Pharma	Different sequence and exon
Amondys 45	Casimersen	45	Sarepta Therapeutics	Different sequence and exon

These products are not biosimilars. They are chemically synthesized antisense oligonucleotides regulated as drug products, and their competitive risk is driven by sequence, backbone, manufacturing, clinical labeling, regulatory exclusivity, and separate patent families rather than by biosimilar interchangeability. [1, 5-8]

What patent litigation and settlement risks apply?

The supplied claims do not establish a litigation history, settlement agreement, or Paragraph IV filing against U.S. Patent 9,018,368. No such event should be inferred from the patent’s existence.

Potential litigation issues include:

Infringement

The principal dispute would be claim construction of “chemically linked to a polyethylene glycol chain” and whether the accused product contains the exact claimed sequence in morpholino form.

Validity

Potential validity challenges could address:

Anticipation by earlier disclosures of the sequence.
Obviousness of combining the sequence, PMO backbone, and PEG conjugation.
Written description and enablement for the claimed PEG-linked structures.
Definiteness of the PEG-linkage limitation.
Double-patenting if related continuation claims overlap.

Enforceability

The record may also be examined for inequitable conduct, prosecution disclosure, terminal disclaimers, maintenance-fee status, and any admissions concerning non-PEG products.

Doctrine of equivalents

A patentee could argue that a non-PEG conjugate performs substantially the same function in substantially the same way to obtain substantially the same result. That argument would face limits if PEG attachment was added during prosecution to distinguish prior art or to secure allowance. The prosecution history is therefore important to any equivalents analysis.

How strong is the patent estate?

The patent is strong in narrow structural terms and weaker as a broad commercial barrier.

Strength factor	Assessment
Exact sequence definition	Strong
Chemical-structure specificity	Strong
Coverage of all exon-51 products	Weak
Coverage of non-PEG eteplirsen	Weak or unavailable on supplied claims
Design-around difficulty	Moderate to low
Composition claim breadth	Moderate, but dependent on PEG-linked structure
Remaining term	Approximately four years from 2025, before adjustments
Regulatory leverage	Depends on Orange Book listing and NDA relationship
Manufacturing leverage	Limited from supplied claims alone

The patent could have meaningful blocking value if a developer selects the exact sequence and adds PEG to improve delivery, pharmacokinetics, tissue distribution, or tolerability. It is less effective against a conventional non-PEG PMO or a different exon-skipping sequence.

What generic launch scenarios exist?

Scenario 1: Non-PEG PMO using the same sequence

This is the clearest design-around scenario. The proposed product would retain the sequence and morpholino concept but omit PEG. It would still face other patents, regulatory requirements, manufacturing controls, and possible method claims, but the supplied claims would present a substantial non-infringement argument.

Scenario 2: PEG-linked PMO using the exact sequence

This is the highest-risk scenario. Both claims could potentially read on the active molecule, and claim 2 could apply to the finished pharmaceutical composition.

Scenario 3: Different exon-51 sequence

A different sequence could avoid the exact-sequence limitation but would require separate analysis of target engagement, exon-skipping performance, regulatory equivalence, and other patent claims.

Scenario 4: Different exon target

Products targeting exons 45 or 53 are outside the supplied sequence claim, although they may be subject to separate patent estates.

What manufacturing and IP barriers remain after patent expiration?

Patent expiration would not remove all barriers to competition. A competing manufacturer would still need to address:

PMO synthesis and sequence-specific impurity control.
PEG conjugation reproducibility, if applicable.
Removal of truncated oligomers and residual reagents.
Identity, purity, potency, and sterility testing.
Scale-up of solid-phase synthesis.
Injectable formulation stability.
FDA approval requirements.
Trade-secret manufacturing processes.
Separate patents covering methods, formulations, delivery systems, or related sequences.
Orphan-drug and other regulatory exclusivities, if applicable.

For antisense products, manufacturing know-how can affect commercial entry even where the core composition patent has expired.

Key Takeaways

U.S. Patent 9,018,368 claims an exact 30-base dystrophin exon-51 sequence in morpholino form with a chemically attached PEG chain.
Claim 2 adds a pharmaceutical composition containing that same PEG-linked oligomer and a pharmaceutically acceptable carrier.
The claims do not broadly cover all exon-51-skipping PMOs or all eteplirsen products.
The PEG limitation is the central infringement boundary.
A non-PEG PMO using the same sequence has a substantial argument that it falls outside the supplied claims.
The ordinary projected patent expiration is November 2029, subject to USPTO term adjustments and disclaimers.
Orange Book coverage cannot be assumed from sequence association with Exondys 51; current FDA listing data control.
Exon-skipping competitors targeting exons 45 and 53 are outside the supplied sequence claims but remain subject to separate patent and regulatory estates.
The patent’s strongest commercial value is as a barrier to PEG-conjugated versions of the exact sequence.

FAQs About U.S. Patent 9,018,368

Does U.S. Patent 9,018,368 cover eteplirsen?

Not necessarily. The claims require PEG attachment, while approved eteplirsen is described as a PMO without PEG identified as part of the active ingredient. Sequence overlap alone does not establish claim coverage.

Can a company commercialize the same 30-base sequence without PEG?

The supplied claims would not literally cover an otherwise matching morpholino that lacks the required PEG linkage. Other patents and regulatory requirements could still apply.

Does the patent cover a PEG excipient added to an injection?

Not ordinarily. The PEG must be chemically linked to the antisense oligonucleotide, rather than merely present as a free formulation ingredient.

Are golodirsen, viltolarsen, and casimersen covered by this patent?

The supplied sequence claim does not cover them because they target different dystrophin exons and use different antisense sequences.

Could the patent block a PEG-linked exon-51 drug after November 2029?

This patent would no longer block post-expiration activity, subject to the actual expiration date. Separate patents, regulatory exclusivity, manufacturing patents, and trade-secret rights could remain relevant.

References

U.S. Food and Drug Administration. (2024). Exondys 51 (eteplirsen) prescribing information. FDA.
United States Patent and Trademark Office. (2024). Patent term adjustment and patent term calculation guidance. USPTO.
U.S. Food and Drug Administration. (2024). Approved drug products with therapeutic equivalence evaluations. FDA.
U.S. Food and Drug Administration. (2024). ANDA submissions: Patent certification and 30-month stay provisions. FDA.
U.S. Food and Drug Administration. (2024). Vyondys 53 (golodirsen) prescribing information. FDA.
U.S. Food and Drug Administration. (2024). Viltepso (viltolarsen) prescribing information. FDA.
U.S. Food and Drug Administration. (2024). Amondys 45 (casimersen) prescribing information. FDA.
United States Patent and Trademark Office. (2015). U.S. Patent No. 9,018,368. USPTO.

Foriegn Application Priority Data
Foreign Country	Foreign Patent Number	Foreign Patent Date
Australia	2004903474	Jun 28, 2004

Country	Patent Number	Estimated Expiration	Supplementary Protection Certificate	SPC Country	SPC Expiration
Austria	E498685	⤷ Start Trial
Cyprus	1111447	⤷ Start Trial
Cyprus	1117475	⤷ Start Trial
Germany	602005026386	⤷ Start Trial
>Country	>Patent Number	>Estimated Expiration	>Supplementary Protection Certificate	>SPC Country	>SPC Expiration

Details for Patent: 9,018,368

Summary for Patent: 9,018,368