US Patent 10,781,451: Eteplirsen Antisense Oligonucleotide Claims, Patent Scope, and Generic Entry Risk

US Patent 10,781,451 is a sequence-specific patent covering the 30-base morpholino antisense oligonucleotide used in eteplirsen, marketed by Sarepta Therapeutics as Exondys 51 for Duchenne muscular dystrophy. The patent’s strongest protection is claim 1, which covers the exact 30-base sequence in morpholino chemistry. Claims 2 through 14 extend protection to selected conjugates, injectable formulations, carriers, and administration routes.

The patent does not broadly claim all exon 51-skipping oligonucleotides, all morpholino oligomers, or all treatments for Duchenne muscular dystrophy. Its commercial relevance depends on whether a competing product uses the same sequence and morpholino backbone, or falls within the formulation and conjugate limitations of the dependent claims.

Item	Assessment
Patent	US 10,781,451 B2
Technology	Morpholino antisense oligonucleotide
Core product	Eteplirsen, Exondys 51
Claimed target	DMD exon-skipping sequence associated with exon 51
Core sequence	30-base sequence corresponding to CTCCAACATCAAGGAAGATGGCATTTCT
Patent owner/commercial sponsor	Sarepta Therapeutics and related predecessors or affiliates
Grant date	September 22, 2020
Earliest priority	2008 priority chain
Expected ordinary expiration	Approximately August 2029, subject to the official patent-term calculation
FDA product	Exondys 51, NDA 206488
Regulatory category	Chemically synthesized antisense drug, not a biosimilar biologic
Main competitive risk	Sequence-specific generic or follow-on product using the same PMO sequence

What does US Patent 10,781,451 cover?

The patent covers a specific phosphorodiamidate morpholino oligomer, or PMO, having the sequence recited in claim 1. The sequence is written with RNA-style uracil notation, but the claim expressly converts uracil bases to thymine bases:

CTCCAACATCAAGGAAGATGGCATTTCT

The sequence contains 30 bases. Claim 1 also requires that the oligonucleotide be a morpholino antisense oligonucleotide. Both limitations are material.

The claim therefore requires:

The exact 30-base sequence.
Thymine in place of uracil.
Morpholino antisense chemistry.

The patent does not merely cover a nucleic acid capable of binding the same DMD region. A competing compound with a different sequence, even if it induces exon 51 skipping, would not literally satisfy claim 1 unless the difference were legally treated as an equivalent.

What is the relationship to eteplirsen?

The claimed sequence corresponds to eteplirsen, the PMO drug in Exondys 51. Eteplirsen is designed to bind the DMD pre-mRNA and promote skipping of exon 51. Exon skipping allows production of a shorter dystrophin transcript in certain patients with mutations amenable to exon 51 skipping. The FDA approved Exondys 51 in 2016 under the accelerated approval pathway based on dystrophin production as a surrogate endpoint. [2]

The patent claim is narrower than the full commercial product concept. Eteplirsen’s commercial and regulatory position also depends on manufacturing specifications, release testing, dosage, labeling, clinical data, and other patent families.

How broad is claim 1?

Claim 1 is a narrow composition-of-matter claim with potentially strong literal enforceability against an identical PMO sequence.

It does not limit the claim by:

Conjugation status;
Dose;
Concentration;
Route of administration;
Patient age;
DMD mutation;
Exon-skipping percentage;
Treatment duration;
Pharmaceutical carrier;
Manufacturing process.

A product using the exact sequence in morpholino form could infringe claim 1 even if it is supplied at a different concentration, administered at a different dose, or manufactured by a different process.

The claim is narrower in other respects. It does not expressly cover:

A phosphorodiamidate morpholino sequence with one or more substitutions;
A peptide nucleic acid;
A 2'-O-methyl phosphorothioate oligonucleotide;
A locked nucleic acid;
An siRNA;
A different exon 51-skipping sequence;
A non-oligonucleotide exon-skipping agent.

A different chemical backbone may avoid literal infringement, but the availability of that design-around depends on whether the alternative still satisfies the patent’s morpholino limitation and whether other patents cover the alternative chemistry.

What do claims 2 through 14 add?

Claims 2 through 14 are dependent claims. They inherit all limitations of claim 1 or the relevant injectable-solution claim.

Claims	Added limitation	Commercial significance
2	Chemical linkage to specified moieties	Covers selected conjugated forms of the sequence
3	Injectable solution for intravenous administration	Covers IV formulation and route
4	Listed conjugates in IV solution	Combines IV formulation with specified chemical linkage
5	Isotonic saline carrier or diluent	Covers saline-based IV formulation
6	Phosphate-buffered saline	Narrower formulation claim
7	Injectable solution for parenteral administration	Broader than IV, but still limited to injectable use
8	Listed conjugates in parenteral solution	Combination formulation claim
9	Isotonic saline carrier or diluent	Carrier limitation
10	Phosphate-buffered saline	Narrower formulation limitation
11	Injectable solution for intramuscular administration	Route-specific claim
12	Listed conjugates in intramuscular solution	Combination claim
13	Isotonic saline carrier or diluent	Carrier limitation
14	Phosphate-buffered saline	Narrowest formulation claim

Are the conjugate claims commercially important?

Claim 2 lists cholesterol, cholic acid, thioether, thiocholesterol, aliphatic-chain, phospholipid, polyamine, polyethylene-glycol, adamantane acetic acid, palmityl, octadecylamine, and hexylamino-carbonyl-oxycholesterol moieties.

The list is extensive but still closed by its wording. A conjugate that uses an unrelated chemical group may not satisfy the literal language of claim 2. The conjugate claims also require a chemical linkage to the morpholino oligonucleotide. A mixture, co-formulation, or physical association may not satisfy that limitation.

The practical importance of these claims is limited for the currently marketed Exondys 51 presentation if the commercial product does not use one of the listed conjugates. Their principal value is defensive: they may constrain alternative delivery systems that retain the same sequence and use one of the specified chemical modifications.

What formulations are protected by US 10,781,451?

The formulation claims cover injectable solutions containing the claimed PMO and a pharmaceutically acceptable carrier or diluent.

The patent expressly identifies:

Intravenous administration;
Parenteral administration;
Intramuscular administration;
Isotonic saline;
Phosphate-buffered saline.

Claim 3 is the principal IV formulation claim. Claim 7 covers parenteral administration, which generally includes IV and intramuscular delivery but may also encompass other injection routes depending on the construction applied. Claim 11 separately addresses intramuscular administration.

The claims do not expressly require:

A specific dose;
A particular pH;
A specified concentration;
A preservative;
A particular vial or container;
A particular injection volume;
A specific excipient other than the carrier limitations in claims 5, 6, 9, 10, 13, and 14.

An injectable product containing the identical PMO may face claim 1 risk even if its formulation avoids the narrower saline or phosphate-buffered saline limitations.

When does US Patent 10,781,451 lose exclusivity?

The patent’s ordinary term is tied to the earliest effective nonprovisional priority date in its family, rather than the 2020 grant date. The relevant priority chain dates to 2008. On that basis, the expected expiration is approximately August 2029, subject to the official USPTO patent-term adjustment, terminal disclaimers, and any applicable patent-term extension.

The expiration analysis should distinguish patent rights from FDA regulatory exclusivity.

Protection	Expected timing	Effect
US 10,781,451 patent term	Approximately August 2029	Blocks covered compositions and formulations until expiration
Pediatric exclusivity	Six months if attached to the applicable FDA exclusivity period	Can extend certain listed patents or regulatory protections
Orphan-drug exclusivity	Product and indication dependent	May restrict approval of the same drug for the protected indication
FDA approval exclusivity	Product-specific	Separate from patent infringement
Patent-term extension	Must be confirmed in USPTO and FDA records	May extend a qualifying patent beyond its ordinary term

The patent cannot be assessed solely from its grant date. Continuation practice does not ordinarily create a new 20-year term. The relevant term generally runs from the earliest effective nonprovisional filing date in the chain.

What is the Orange Book status of Exondys 51?

Exondys 51 is approved under NDA 206488 and is included in the FDA’s drug-product framework for approved chemically synthesized drugs. FDA patent-listing records should be reviewed for the current status of US 10,781,451 and related patents because Orange Book listings can change through delisting, expiration, corrections, or patent-listing updates. [3]

The patent is relevant to an abbreviated application only if:

The reference product is eligible for an ANDA or other abbreviated pathway.
The applicant relies on the relevant reference product.
The listed patent is properly submitted and applicable to the proposed product.
The applicant makes the required patent certification.

An NDA applicant using a different clinical or regulatory pathway may face a different patent-certification framework.

Does Exondys 51 have biologic biosimilar risk?

No conventional biosimilar pathway applies to eteplirsen merely because it is a complex oligonucleotide. Eteplirsen is a chemically synthesized PMO drug regulated as a drug product, not a therapeutic protein approved under a biologics license application.

The principal follow-on risks are:

An ANDA, if FDA determines the product and reference product are eligible;
A 505(b)(2) application;
A full NDA for a differentiated exon-skipping product;
A competing PMO or non-PMO product supported by independent clinical data.

A follow-on applicant cannot avoid patent risk by labeling its product a biosimilar.

What Paragraph IV challenges could affect this patent?

A generic or follow-on applicant could challenge US 10,781,451 through a Paragraph IV certification if the patent is listed for the relevant reference product and the applicant asserts that the patent is invalid, unenforceable, or not infringed.

Potential Paragraph IV theories include:

Noninfringement based on a non-morpholino backbone;
Noninfringement based on a sequence variation;
Invalidity for lack of written description;
Invalidity for lack of enablement;
Obviousness based on prior antisense sequences and PMO chemistry;
Indefiniteness in the formulation or conjugate language;
Lack of patent-listing relevance to the proposed product.

Claim 1 presents a different risk profile from the formulation claims. An applicant using the identical sequence and PMO backbone would have difficulty avoiding the composition claim through changes to dose, carrier, concentration, or route. A competitor using a modified sequence or a different antisense chemistry would have stronger noninfringement arguments but could still encounter other patents.

No conclusion that a particular Paragraph IV notice has been served should be drawn from the patent grant alone. Paragraph IV activity is applicant-specific and must be confirmed through FDA and district-court records.

How strong is the patent estate for eteplirsen?

The estate is strongest against an exact-copy PMO product and weaker against a differentiated exon-skipping platform.

Risk category	Relative strength	Reason
Identical 30-base PMO	High	Claim 1 directly recites the sequence and chemistry
Same PMO with different dose	High	Dose is not a limitation of claim 1
Same PMO with different injectable carrier	High under claim 1	Formulation changes do not avoid the composition claim
Same sequence with listed conjugate	High	Claims 2 and 4, 8, and 12 may apply
Same sequence in PBS injection	High	Claims 3-6, 7-10, or 11-14 may apply depending on route
One-base sequence change	Lower under literal infringement	Requires analysis of claim construction and equivalents
Different antisense chemistry	Lower for this patent	May avoid the morpholino limitation
Different exon 51-skipping sequence	Lower for this patent	Claim 1 is sequence-specific
Noninjectable product	Lower under formulation claims	Claim 1 may still apply if the product is the same PMO

The patent’s narrow sequence scope is both a strength and a limitation. It creates a direct barrier to copying eteplirsen but does not block the entire exon 51-skipping field.

Which companies are challenging or competing with eteplirsen?

The most relevant competitive products are other DMD exon-skipping drugs, although they target different exons and are not direct substitutes for the sequence claimed in US 10,781,451.

Product	Sponsor	Chemistry	Target exon	Relationship to eteplirsen
Exondys 51, eteplirsen	Sarepta	PMO	51	Direct reference product
Vyondys 53, golodirsen	Sarepta	PMO	53	Adjacent exon-skipping competitor
Viltepso, viltolarsen	NS Pharma	PMO	53	Competes in DMD treatment, not same sequence
Amondys 45, casimersen	Sarepta	PMO	45	Different exon and sequence
Other exon-skipping programs	Multiple developers	PMO or alternative chemistries	Various	Platform and indication competition

A competitor targeting exon 51 with a different sequence could avoid literal infringement of claim 1, but it would need to establish clinical activity, dystrophin production, safety, and regulatory acceptability. The existence of an alternative exon 51 sequence would not automatically establish freedom to operate because other patent families may cover the target region, chemistry, delivery, or therapeutic use.

What patent litigation affects US 10,781,451?

The relevant litigation questions are:

Whether Sarepta has asserted the patent against an ANDA or 505(b)(2) applicant.
Whether the patent is listed for the proposed reference product.
Whether a 30-month stay has been triggered by a Paragraph IV notice.
Whether the patent has been challenged in inter partes review or post-grant proceedings.
Whether related continuation patents are being asserted even if this patent is not.

A public patent grant does not establish that litigation is pending. The litigation exposure should be evaluated across the entire eteplirsen patent family, not only US 10,781,451. Patent-family assertions may include composition, therapeutic-use, manufacturing, dosing, and formulation claims.

What generic launch scenarios exist?

Scenario 1: Exact-copy PMO

A company seeking to sell the same 30-base PMO would face the highest risk. Claim 1 could remain enforceable regardless of changes to formulation, dose, or administration schedule until patent expiration.

Scenario 2: Modified-sequence PMO

A one- or several-base modification could create a noninfringement position. The commercial challenge is proving that the modified sequence produces sufficient exon 51 skipping and clinically meaningful dystrophin restoration.

Scenario 3: Different antisense chemistry

A peptide nucleic acid, 2'-O-methyl phosphorothioate, locked nucleic acid, or another chemistry may avoid the morpholino limitation. Other patent estates and toxicity, delivery, and regulatory issues would remain.

Scenario 4: 505(b)(2) follow-on

A 505(b)(2) applicant could seek approval based partly on Exondys 51 while introducing formulation or manufacturing differences. Patent certifications and reliance on the reference product would determine the litigation pathway.

Scenario 5: Post-expiration entry

After the relevant patent term ends, an exact-copy product may still face FDA requirements, manufacturing validation, product-quality specifications, and other unexpired patents. Patent expiration does not eliminate regulatory or technical barriers.

What manufacturing and geographic barriers remain?

The patent claims do not appear to be limited to a particular manufacturing process. A manufacturer therefore may avoid process-specific infringement under this patent if it uses a different synthetic route, provided the resulting product does not infringe the composition or formulation claims.

The main manufacturing barriers are technical:

Controlled oligomer synthesis;
Removal of deletion sequences and process impurities;
Characterization of full-length PMO;
Batch consistency;
Analytical methods;
Sterility and endotoxin control;
Scale-up of injectable drug substance and product;
Demonstration of comparability for a follow-on product.

US 10,781,451 is a United States patent. Parallel rights may exist in Europe, Japan, China, Australia, Canada, and other jurisdictions through the underlying patent family. Geographic freedom to operate must be assessed country by country because claim scope, patent-term calculations, prosecution history, and regulatory exclusivity differ by jurisdiction.

What is the revenue exposure?

Exondys 51 is a material Sarepta product and the company’s revenue exposure is linked to continued treatment of patients with DMD mutations amenable to exon 51 skipping. Sarepta has reported hundreds of millions of dollars in annual Exondys 51 product revenue, making the product relevant to generic-entry and patent-expiration analysis. [4]

The exposure is moderated by:

The limited population eligible for exon 51 skipping;
Competition from other DMD therapies;
Treatment-center capacity;
Reimbursement and payer controls;
Safety and efficacy requirements for follow-on products;
The possibility that a challenger targets the same exon with a different sequence.

Key Takeaways

US 10,781,451 claims the exact 30-base eteplirsen PMO sequence.
Claim 1 is the principal barrier to an exact-copy product.
Changes to dose, carrier, concentration, or route generally do not avoid claim 1.
Claims 2 through 14 cover selected conjugates and injectable formulations, including saline and phosphate-buffered saline.
The patent does not broadly cover every exon 51-skipping oligonucleotide.
A different sequence or non-morpholino chemistry may provide a design-around, subject to other patents and regulatory requirements.
The expected ordinary patent expiration is approximately August 2029, based on the 2008 priority chain and subject to official term adjustments.
Eteplirsen is a chemically synthesized drug, so biosimilar terminology is generally inapplicable.
Generic or follow-on entry would likely require analysis under an ANDA, 505(b)(2), or full NDA pathway.
The highest commercial risk is an exact-copy PMO product seeking approval before patent expiration.

Frequently Asked Questions

Does US 10,781,451 cover all exon 51-skipping drugs?

No. It covers the recited 30-base sequence in morpholino antisense form. A different exon 51-skipping sequence or chemistry may fall outside the claims.

Can a generic avoid the patent by changing the injection vehicle?

Changing the carrier may avoid a narrower formulation claim, but it would not ordinarily avoid claim 1 if the product still contains the same 30-base morpholino sequence.

Is eteplirsen protected by a biologic patent pathway?

No. Eteplirsen is a chemically synthesized PMO drug. Its follow-on regulatory and patent issues differ from those for protein biologics regulated through a BLA.

Does a one-base sequence change guarantee freedom to operate?

No. It may support a literal noninfringement position, but the modified product could face an equivalents argument, other sequence patents, method-of-use patents, or separate formulation and manufacturing claims.

What is the most important patent claim for an Exondys 51 competitor?

Claim 1 is the most important because it directly covers the exact eteplirsen PMO composition without limiting the dose, route, carrier, or concentration.

References

United States Patent and Trademark Office. (2020). U.S. Patent No. 10,781,451, antisense oligonucleotide and injectable formulations. U.S. Department of Commerce.
U.S. Food and Drug Administration. (2016). Exondys 51 (eteplirsen) prescribing information and approval materials. FDA.
U.S. Food and Drug Administration. (2024). Approved drug products with therapeutic equivalence evaluations, Orange Book. FDA.
Sarepta Therapeutics, Inc. (2024). Annual report on Form 10-K for the fiscal year ended December 31, 2023. U.S. Securities and Exchange Commission.

Foriegn Application Priority Data
Foreign Country	Foreign Patent Number	Foreign Patent Date
Australia	2004903474	Jun 28, 2004

Country	Patent Number	Estimated Expiration	Supplementary Protection Certificate	SPC Country	SPC Expiration
Austria	E498685	⤷ Start Trial
Cyprus	1111447	⤷ Start Trial
Cyprus	1117475	⤷ Start Trial
>Country	>Patent Number	>Estimated Expiration	>Supplementary Protection Certificate	>SPC Country	>SPC Expiration

Details for Patent: 10,781,451

Summary for Patent: 10,781,451