Details for Patent: 9,476,042

Title:	Spinal muscular atrophy (SMA) treatment via targeting of SMN2 splice site inhibitory sequences
Abstract:	The present invention is directed to methods and compositions capable of blocking the inhibitory effect of a newly-identified intronic inhibitory sequence element, named ISS-N1 (for "intronic splicing silencer"), located in the SMN2 gene. The compositions and methods of the instant invention include oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target the SMN2 ISS-N1 site in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The ISS-N1 blocking agents of the invention cause elevated expression of SMN protein, thus compensating for the loss of SMN protein expression commonly observed in subjects with spinal muscular atrophy (SMA).
Inventor(s):	Singh; Ravindra N. (Shrewsbury, MA), Singh; Natalia N. (Shrewsbury, MA), Singh; Nirmal K. (Temple, TX), Androphy; Elliot J. (Natick, MA)
Assignee:	UNIVERSITY OF MASSACHUSETTS (Boston, MA)
Filing Date:	Oct 15, 2013
Application Number:	14/054,055
Claims:	1. An oligonucleotide consisting of 15 to 40 linked nucleotides or modified nucleotides in length, wherein the oligonucleotide comprises at least one morpholino moiety, and wherein the oligonucleotide comprises a nucleobase sequence at least 80% complementary to intron 7 of the SMN2 gene over the entire length of the oligonucleotide. 2. The oligonucleotide of claim 1, which is at least 90% complementary to the sequence 5'-CCAGCAUUAUGAAAG-3' (SEQ ID NO: 3). 3. The oligonucleotide of claim 1 which is 100% complementary to the sequence 5'-CCAGCAUUAUGAAAG-3' (SEQ ID NO: 3). 4. The oligonucleotide of claim 1 comprising the sequence 5'-CUUUCAUAAUGCUGG-3' (SEQ ID NO: 4). 5. The oligonucleotide of claim 1, which is 15-20 nucleotides in length. 6. The oligonucleotide of claim 1, which is 20-25 nucleotides in length. 7. The oligonucleotide of claim 1, which is 18 nucleotides in length. 8. The oligonucleotide of claim 1, wherein one or more nucleotides comprises a modified nucleobase. 9. The oligonucleotide of claim 1, wherein each riboside moiety of each subunit of the oligonucleotide is a morpholine moiety. 10. A composition comprising the oligonucleotide of claim 1 and a pharmaceutically acceptable carrier. 11. The oligonucleotide of claim 1, which comprises the complement of the nucleobase sequence CCAGCAUUAUGAAAGUGAAU, set forth as nucleobases 10-29 of SEQ ID NO:103. 12. The oligonucleotide of claim 10, which consists of the complement of the nucleobase sequence CCAGCAUUAUGAAAGUGAAU, set forth as nucleobases 10-29 of SEQ ID NO:103. 13. A method of increasing the level of exon 7-containing SMN2 mRNA in a cell comprising contacting the cell with the oligonucleotide of claim 1, such that the level of exon 7-containing SMN2 mRNA in the cell is increased. 14. The method of claim 13, wherein the oligonucleotide is 15-40 nucleotides in length and is 100% complementary to intron 7 of the SMN2 gene over the full length of the oligonucleotide. 15. The method of claim 13, wherein the oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 4. 16. The method of claim 13, wherein the oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 3. 17. The method of claim 16, wherein the oligonucleotide is 15-20 nucleotides in length. 18. The method of claim 16, wherein the oligonucleotide is 20-25 nucleotides in length. 19. The method of claim 16, wherein the oligonucleotide is 18 nucleotides in length. 20. The oligonucleotide of claim 8, wherein the modified nucleobase is 5-methyl-cytosine. 21. The oligonucleotide of claim 1, wherein the oligonucleotide is complementary to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3 and SEQ ID NO:5.