.

Pharmaceutical Business Intelligence

  • Anticipate P&T budget requirements
  • Evaluate market entry opportunities
  • Find generic sources and suppliers
  • Predict branded drug patent expiration

► Plans and Pricing

Upgrade to enjoy subscriber-only features like email alerts and data export. See the Plans and Pricing

DrugPatentWatch Database Preview

Details for Patent: 6,835,557

« Back to Dashboard

Details for Patent: 6,835,557

Title: DNA sequences, recombinant DNA molecules and processes for producing human interferon-like polypeptides
Abstract:DNA sequences, recombinant DNA molecules and hosts transformed with them which produce polypeptides displaying a biological or immunological activity of human interferon, the genes coding for these polypeptides and methods of making and using these molecules, hosts, genes and polypeptides. The DNA sequences are characterized in that they code for a polypeptide displaying a biological or immunological activity of human interferon. In appropriate hosts these DNA sequences and recombinant DNA molecules permit the production and identification of genes and polypeptides displaying a biological or immunological activity of human interferon and their use in antiviral and antitumor or anticancer agents.
Inventor(s): Weissmann; Charles (Zurich, CH)
Assignee: Biogen, Inc. (Cambridge, MA)
Filing Date:Jun 07, 1995
Application Number:08/487,280
Claims:1. A recombinant DNA molecule comprising: (a) the portion of a DNA sequence selected from the group consisting of the following subcloned fragments that hybridizes to at least one of the DNA inserts of Z-pBR322 (Pst)/HcIF-II-206 and Z-pBR322 (Pst)/HcIF-SN35-AHL6: HchrIF-A, the subcloned HindIII fragment of chr 3 in E.coli HB101; HchrIF-B, the subcloned EcoRI fragment of chr 12 in E.coli HB101; HchrIF-C, the subcloned HindIII fragment of chr 12 in E.coli HB101; HchrIF-D, the subcloned EcoRI fragment of chr 13 in E.coli HB101; HchrIF-E, the subcloned EcoRI fragment of chr 23 in E.coli HB101; HchrIF-F, the subdloned HindIII fragment of chr 23 in E.coli HB101; HchrIF-G, the subcloned EcoRI fragment of chr 26 in E.coli HB 101; and HchrEF-H, the subcloned HindIII fragment of chr 26 in E.coli HB101, or (b) a DNA sequence that on expression codes for a polypeptide coded for on expression by said hybridizing portion of any of the foregoing DNA inserts.

2. A recombinant DNA molecule comprising a DNA sequence selected from the group consisting of: (a) DNA sequences of the formula:

TTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGATCTGCCTCAAACCCACAGC CTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCTCTTTTCTCCTGCTTGAAGGACAGA CATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAG ATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAA TTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGGGTGACAGAGACT CCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAG AAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAA GAAAGTTAAGAAGTAAGGAA and

TGTGATCTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCT CTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCT GAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCT TGGGATGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATA CAGGGGGTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGA ATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCT TTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAA, and (b) a DNA sequence that on expression codes for a polypeptide coded for on expression by either of the foregoing DNA sequences.

3. A recombinant DNA molecule comprising a DNA sequence selected from the group consisting of: (a) DNA sequences of the formula:

ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGTTCTCTGGGCTGTGAT CTGCCTCAGACCCACAGCCTGGGTAATAGGAGGACCTTGATACTCCTGCAACAAATGGGAAGAATCTCTCATTTC TCCTGCCTGAAGGACAGACATGATTTCGGATTCCCCGAGGAGGAGTTTGATGGCCACCAGTTCCAGAAGACTCAA GCCATCTCTGTCCTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCTGCTTGG GAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATGACCTGGAAGCATGTGTGATACAG GAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGTGGACTCCATCCTGGCTGTGAGGAAATACTTCCAAAGAATC ACTCTTTATCTAACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTC TCGTTTTCAACAAACTTGCAAAAAAGATTAAGGAGGAAGGATand

TGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGACCTTGATACTCCTGCAACAAATGGGAAGAATCTCT CATTTCTCCTGCCTGAAGGACAGACATGATTTCGGATTCCCCGAGGAGGAGTTTGATGGCCACCAGTTCCAGAAG ACTCAAGCCATCTCTGTCCTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCT GCTTGGGAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATGACCTGGAAGCATGTGTG ATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGTGGACTCCATCCTGGCTGTGAGGAAATACTTCCAA AGAATCACTCTTTATCTAACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGA TCCCTCTCGTTTTCAACAAACTTGCAAAAAAGATTAAGGAGGAAGGAT, and (b)a DNA sequence that on expression codes for a molypeptide coded for on expression by either of the foregoing DNA sequences.

4. The recombinant DNA molecule according to claim 1 or 3, wherein said DNA sequence is operatively linked to an expression control sequence.

5. The recombinant DNA molecule according to claim 4, wherein said expression control sequence controls the expression of genes of prokaryotic or eukaryotic cells and their viruses.

6. The recombinant DNA molecule according to claim 5, wherein said expression control sequence is selected from the group consisting of a lac system, .beta.-lac system, a trp system, major operator and promoter regions of phage .lambda., and the control region of fd coat protein.

7. A recombinant DNA molecule selected from the group consisting of C8-IFN-.alpha.2, LAC-AUG(.alpha.2) and .beta.-lac-AUG(.alpha.2).

8. A host cell transformed with at least one recombinant DNA molecule according to any one of claims 1, 3 and 7.

9. The host cell of claim 8 selected from the group consisting of bacteria, yeasts, animal cells in culture, and human tissue cells.

10. A host cell transformed with at least one recombinant DNA molecule according to claim 4.

11. The host cell of claim 10 wherein said expression control sequence controls the expression of genes of prokaryotic or eukaryotic cells and their viruses.

12. The host cell of claim 11 wherein said expression control sequence is selected from the group consisting of a lac system, a .beta.-lac system, a trp system, major operator and promoter regions of phage .lambda., and the control region of fd coat protein.

13. The host cell of claim 10 selected from the group consisting of bacteria, yeasts, animal cells in culture, and human tissue cells.

14. The recombinant DNA molecule according to claim 2, wherein said DNA sequence is operatively linked to an expression control sequence.

15. The recombinant DNA molecule according to claim 14, wherein said expression control sequence controls the expression of genes of prokaryotic or eukaryotic cells and their viruses.

16. The recombinant DNA molecule according to claim 15, wherein said expression control sequence is selected from the group consisting of a lac system, a .beta.-lac system, a trp system, major operator and promoter regions of phage .lambda., and the control region of fd coat protein.

17. A host cell transformed with at least one recombinant DNA molecule according to any one of claims 2 and 14-16.

18. The host cell of claim 17 selected from the group consisting of bacteria, yeasts, animal cells in culture, and human tissue cells.

19. A method for producing a recombinant DNA molecule comprising a DNA sequence selected from the group consisting of: (a) DNA sequences of the formula:

ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGTTCTCTGGGCTGTGAT CTGCCTCAGACCCACAGCCTGGGTAATAGGAGGACCTTGATACTCCTGCAACAAATGGGAAGAATCTCTCATTTC TCCTGCCTGAAGGACAGACATGATTTCGGATTCCCCGAGGAGGAGTTTGATGGCCACCAGTTCCAGAAGACTCAA GCCATCTCTGTCCTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCTGCTTGG GAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTTACCAGCAACTGAATGACCTGGAAGCATGTGTGATACA GGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGTGGACTCCATCCTGGCTGTGAGGAAATACTTCCAAAGAAT CACTCTTTATCTAACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCT CTCGTTTTCAACAAACTTGCAAAAAAGATTAAGGAGGAAGGAT and TGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGACCTTGATACTCCTGCAACAAATGGGAAGAATCTC TCATTTCTCCTGCCTGAAGGACAGACATGATTTCGGATTCCCCGAGGAGGAGTTTGATGGCCACCAGTTCCAGAA GACTCAAGCCATCTCTGTCCTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGC TGCTTGGGAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATGACCTGGAAGCATGTGT GATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGTGGACTCCATCCTGGCTGTGAGGAAATACTTCCA AAGAATCACTCTTTATCTAACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAG ATCCCTCTCGTTTTCAACAAACTTGCAAAAAAGATTAAGGAGGAAGGAT, and (b) a DNA sequence that on expression codes for a polypeptide coded for on expression by either of the foregoing DNA sequences, comprising the step of culturing a host cell containing at least one recombinant DNA molecule of claim 3 under conditions in which the host cell replicates the recombinant DNA molecule.

20. A transformed host cell, wherein said host cell is E.coli HB101 (Z-pBR322(Pst)/HcIF-II-206).

21. A transformed host cell selected from the group consisting of HchrIF-A, wherein HcHrIF-A is the subcloned HindIII fragment of chr 3 in E.coli HB101; HchrIF-B, wherein HcHrIF-B is the subcloned EcoRI fragment of chr 12 in E.coli HB101; HchrIF-C, wherein HcHrIF-C is the subeloned HindIII fragment of chr 12 in E.coli HB101; HchrIF-D, wherein HchrIF-D is the subcloned EcoRI fragment of chr 13 in E.coli HB101; HcHrIF-E, wherein HcHrIF-E is the subcloned EcoRI fragment of chr 23 in E.coli HB101; HchrIF-F, wherein HchrIF-F is the subcloned HindIII fragment of chr 23 in E.coli HB101; HcHrIF-G, wherein HchrIF-G is the subcloned EcoRI fragment of chr 26 in E.coli HB101; and HchrIF-H, wherein HchrIF-H is the subcloned HindIII fragment of chr 26 in E.coli HB101.

22. A transformed host cell selected from the group consisting of E.coli DS410 (C8-IFN-.alpha.2), E.coli DS410 (LAC-AUG(.alpha.2)) and E.coli DS410 HB101 (.beta.lac-AUG(.alpha.2)).

23. A method for producing a recombinant DNA molccule comprising a DNA sequence selected from the group consisting of: (a) DNA sequences of the formula:

TTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGATCTGCCTCAAACCCACAGC CTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCTCTTTTCTCCTGCTTGAAGGACAGA CATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAG ATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAA TTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGGGTGACAGAGACT CCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAG AAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAA GAAAGTTTAAGAAGTAAGGAA and

TGTGATCTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCT CTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCT GAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCT TGGGATGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATA CAGGGGGTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGA ATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCT TTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAA, and (b) a DNA sequence that on expression codes for a polypeptide coded for on expression by either of the foregoing DNA sequences; comprising the step of culturing a host cell containing at least one recombinant DNA molecule of claim 2 under conditions in which the host cell replicates the recombinant DNA molecule.

24. A DNA sequence coding for an .alpha.-interferon selected from the group consisting of: (a) DNA sequences of the formula:

TTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGATCTGCCTCAAACCCACAGC CTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCTCTTTTCTCCTGCTTGAAGGACAGA CATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAG ATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAA TTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGGGTGACAGAGACT CCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAG AAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAA GAAAGTTTAAGAAGTAAGGAA and

TGTGATCTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCT CTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCT GAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCT TGGGATGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATA CAGGGGGTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGA ATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCT TTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAA, and (b) a DNA sequence that on expression codes for a polypeptide coded for on expression by either of the foregoing DNA sequences.

25. A method for producing a DNA molecule comprising a DNA sequence encoding an .alpha.-interferon comprising the step of culturing a host cell containing a DNA molecule comprising the DNA sequence of claim 24 under conditions in which the host cell replicates the DNA molecule.

26. A DNA sequence coding for an .alpha.-interferon selected from the group consisting of: (a) DNA sequences of the formula:

ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGTTCTCTGGGCTGTGAT CTGCCTCAGACCCACAGCCTGGGTAATAGGAGGACCTTGATACTCCTGCAACAAATGGGAAGAATCTCTCATTTC TCCTGCCTGAAGGACAGACATGATTTCGGATTCCCCGAGGAGGAGTTTGATGGCCACCAGTTCCAGAAGACTCAA GCCATCTCTGTCCTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCTGCTTGG GAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATGACCTGGAAGCATGTGTGATACAG GAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGTGGACTCCATCCTGGCTGTGAGGAAATACTTCCAAAGAATC ACTCTTTATCTAACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTC TCGTTTCAACAAACTTGCAAAAAAGATTAAGGAGGAAGGAT and

TGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGACCTTGATACTCCTGCAACAAATGGGAAGAATCTCT CATTTCTCCTGCCTGAAGGACAGACATGATTTCGGATTCCCCGAGGAGGAGTTTGATGGCCACCAGTTCCAGAAG ACTCAAGCCATCTCTGTCCTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAGAGGACTCATCTGCT GCTTGGGAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAACTGAATGACCTGGAAGCATGTGTG ATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGTGGACTCCATCCTGGCTGTGAGGAAATACTTCCAA AGAATCACTCTTTATCTAACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGA TCCCTCTCGTTTTCAACAAACTTGCAAAAAAGATTAAGGAGGAAGGAT, and (b) a DNA seguence that on expression codes for a polypeptide coded for on expression bv either of the foregoing DNA sequences.

27. A method for producing a DNA molecule comprising a DNA sequence encoding an .alpha.-interferon, comprising the step of culturing a host cell containing a DNA molecule comprising the DNA sequence of claim 26 under conditions in which the host cell replicates DNA molecule.
« Back to Dashboard

For more information try a trial or see the database preview and plans and pricing

Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. thinkBiotech performs no independent verifification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.

`abc