Make Better Decisions - Finding and Evaluating Generic and Branded Drug Market Entry Opportunities

Get the Book: Make Better Decisions

Finding and Evaluating Generic and Branded Drug Market Entry Opportunities

PDF eBook: Just $10 Get Print Book on Amazon

Serving hundreds of leading biopharmaceutical companies globally:

Harvard Business School
Accenture
Covington
Daiichi Sankyo
US Army
McKesson

Generated: August 19, 2019

DrugPatentWatch Database Preview

Patent: 9,125,930

  Try a free trial


See Plans and Pricing

« Back to Dashboard

Summary for Patent: 9,125,930
Title:EGFR aptamer inhibitor for use in therapy and diagnosis
Abstract: The present invention concerns a nucleotide aptamer having the sequence 5\' GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3\' (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.
Inventor(s): De Franciscis; Vittorio (Naples, IT), Cerchia; Laura (Naples, IT)
Assignee: CONSIGLIO NAZIONALE DELLE RICERCHE (Rome, IT)
Application Number:13/876,111
Patent Claims:see list of patent claims

Details for Patent 9,125,930

Applicant Tradename Biologic Ingredient Dosage Form BLA Number Approval Date Patent No. Assignee Estimated Patent Expiration Status Orphan Source
Imclone ERBITUX cetuximab VIAL; INTRAVENOUS 125084 001 2004-06-18   Try a Free Trial CONSIGLIO NAZIONALE DELLE RICERCHE (Rome, IT) 2030-10-12 RX Orphan search
Applicant Tradename Biologic Ingredient Dosage Form BLA Number Approval Date Patent No. Assignee Estimated Patent Expiration Status Orphan Source

Subscribe to access the full database, or try a Free Trial

Make Better Decisions: Try a trial or see plans & pricing

Serving hundreds of leading biopharmaceutical companies globally:

Cipla
Moodys
Farmers Insurance
McKinsey
Accenture
AstraZeneca

Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. thinkBiotech performs no independent verifification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.