Claims for Patent: 9,629,812

Summary for Patent: 9,629,812

Title:	Therapeutic nanoparticles and methods of use thereof
Abstract:	Provided herein are therapeutic nanoparticles having a diameter of between 10 nm to 30 nm, and containing a polymer coating, and a nucleic acid containing a sequence complementary to a sequence within a micro-RNA identified as having a role in cancer cell metastasis or anti-apoptotic activity in a cancer cell (e.g., miR-10b) or a sequence within an mRNA encoding a pro-apoptotic protein that is covalently linked to the nanoparticle. Also provided are pharmaceutical compositions containing these therapeutic nanoparticles. Also provided herein are methods of decreasing cancer cell invasion or metastasis in a subject having a cancer and methods of treating a metastatic cancer in a lymph node in a subject that require the administration of these therapeutic nanoparticles to a subject.
Inventor(s):	Medarova; Zdravka (Methuen, MA), Yigit; Mehmet V. (Delmar, NY), Moore; Anna (Stoneham, MA)
Assignee:	The General Hospital Corporation (Boston, MA)
Application Number:	14/449,590
Patent Claims:	1. A method for treating a metastatic breast cancer in a subject, the method comprising: identifying a subject who has metastatic breast cancer; and administering to the subject a nanoparticle comprising a nucleic acid comprising at least 10 contiguous nucleotides within the sequence of CACAAATTCGGTTCTACAGGGTA (SEQ ID NO: 18) that is covalently or non-covalently linked to the nanoparticle, wherein the nanoparticle is administered in an amount sufficient to treat a breast cancer cell metastatic cancer in a distant site in a subject, and wherein the nanoparticle is administered to the subject by intravenous administration. 2. The method of claim 1, wherein the metastatic breast cancer is localized to the lung, bone, brain, liver, ovary, peritoneum, lymph node, or muscle. 3. The method of claim 1, wherein the nucleic acid comprises SEQ ID NO: 18. 4. The method of claim 1, wherein the nucleic acid comprises at least one modified nucleotide. 5. The method of claim 4, wherein the at least one modified nucleotide is a locked nucleotide. 6. The method of claim 1, wherein the nanoparticle further comprises a covalently-linked fluorophore. 7. The method of claim 6, wherein the fluorophore absorbs near-infrared light. 8. The method of claim 6, wherein the fluorophore is covalently-linked to the nanoparticle through a chemical moiety comprising a secondary amine. 9. The method of claim 1, wherein the nanoparticle further comprises a covalently-linked targeting peptide. 10. The method of claim 9, wherein the targeting peptide comprises: an RGD peptide, an EPPT peptide, NYLHNHPYGTVG (SEQ ID NO: 11), SNPFSKPYGLTV (SEQ ID NO: 12), GLHESTFTQRRL (SEQ ID NO: 13), YPHYSLPGSSTL (SEQ ID NO: 14), SSLEPWHRTTSR (SEQ ID NO: 15), or LPLALPRHNASV (SEQ ID NO: 16), or .beta.Ala-(Arg)7-Cys (SEQ ID NO: 19). 11. The method of claim 9, wherein the targeting peptide is covalently-linked to the nanoparticle through a chemical moiety comprising a disulfide bond. 12. The method of claim 1, wherein the nanoparticle further comprises a polymer coating. 13. The method of claim 1, wherein the nucleic acid is covalently linked to the nanoparticle through a chemical moiety comprising a disulfide bond or a thioether bond. 14. The method of claim 1, further comprising administering one or more additional chemotherapeutic agents, wherein the one or more additional chemotherapeutic agents is administered prior, concurrently, or after administration of the nanoparticle. 15. The method of claim 14, wherein the one or more additional chemotherapeutic agents are selected from the group consisting of cyclophosphamide, mechlorethamine, chlorabucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, valrubicin, paclitaxel, docetaxel, etoposide, teniposide, tafluposide, azacitidine, axathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, tioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, all-trans retinoic acid, vinblastine, vincristine, vindesine, vinorelbine, and bevacizumab. 16. The method of claim 1, further comprising administering a radiotherapy treatment. 17. The method of claim 1, further comprising administering Herceptin.RTM.. 18. The method of claim 12, wherein the polymer coating comprises dextran.

Details for Patent 9,629,812

Applicant	Tradename	Biologic Ingredient	Dosage Form	BLA	Approval Date	Patent No.	Expiredate
Genentech, Inc.	AVASTIN	bevacizumab	Injection	125085	02/26/2004		2031-07-22