Claims for Patent: 9,439,909

Summary for Patent: 9,439,909

Title:	Compositions and methods for sensitizing a neoplastic cell to radiation
Abstract:	The invention provides for the use of radiation sensitizing agents in combination with radiation for the treatment of neoplasia, methods for the identification of genotype-specific radiation sensitizing agents, and methods of identifying patients who could benefit from therapy with a genotype-specific radiation sensitizing agent.
Inventor(s):	Abazeed; Mohamed (Cleveland, OH), Meyerson; Matthew (Concord, MA), Adams; Drew (Cambridge, MA)
Assignee:	The Broad Institute, Inc. (Cambridge, MA) Dana-Farher Cancer Institute, Inc. (Cambridge, MA) President and Fellows of Harvard College (Cambridge, MA)
Application Number:	14/466,668
Patent Claims:	1. A method of sensitizing a non small cell lung cancer cell to radiation, the method comprising contacting the cell with a PI3 kinase inhibitor and exposing the cell to radiation, thereby sensitizing the cell to radiation, wherein the cell comprises a NFE2L2 mutation. 2. A method of enhancing cell death or reducing proliferation in a non small cell lung cancer cell, the method comprising contacting the cell with a PI3 kinase inhibitor and exposing the cell to radiation, thereby enhancing cell death or reducing proliferation in said cell, wherein the cell comprises a NFE2L2 mutation. 3. A method of enhancing radiation sensitivity in a subject having a radiation-resistant non small cell lung cancer, the method comprising administering to the subject radiation and a PI3 kinase inhibitor, thereby enhancing the subject's sensitivity to radiation, wherein radiation resistance is characterized by detecting a NFE2L2 mutation associated with radiation resistance. 4. The method of claim 3, wherein the radiation-susceptibility of the non small cell lung cancer is characterized prior to, during, or following administration of radiation. 5. The method of claim 4, wherein the radiation-susceptibility is characterized by assaying for NRF2 activation or TP53 activation. 6. The method of claim 4, wherein radiation resistance is characterized by detecting a TP53 mutation in the subject, wherein a TP53 missense mutation identifies the neoplasia as radiation resistant and a TP53 disruptive mutation identifies the neoplasia as radiation sensitive. 7. The method of claim 5, wherein the radiation susceptibility is characterized by assaying a TP53 DNA binding domain (aa. 101-305) for mutations. 8. The method of claim 5, wherein the radiation susceptibility is characterized by detecting a TP53 mutation selected from the group consisting of W146*, E171*, Q167*, E298*, V143A, D259V, R249S, M237I, V272M, V143M, R248W, and R158G Intron (ins). 9. The method of claim 4, wherein the NFE2L2 mutation is D77V, P128L, or E79K. 10. The method of claim 1, wherein the PI3 kinase inhibitor is a PI3K alpha selective inhibitor. 11. The method of claim 10, wherein the PI3 kinase inhibitor is LY 294002 or NVP-BKM120. 12. The method of claim 1, wherein the PI3 kinase inhibitor is an inhibitory nucleic acid that reduces NRF2 expression. 13. The method of claim 12, wherein the inhibitory nucleic acid molecule is NRF2-1 shRNA, AGAGCAAGATTTAGATCATTT (SEQ ID NO: 1) and/or NRF2-2 shRNA, GCTCCTACTGTGATGTGAAAT (SEQ ID NO: 2). 14. The method of claim 1, wherein the PI3 kinase inhibitor reduces NRF2-mediated transcription. 15. The method of claim 1, further comprising characterizing radiation resistance of the cell by detecting a TP53 mutation in the cancer, wherein a TP53 missense mutation identifies the cancer as radiation resistant and a TP53 disruptive mutation identifies the cancer as radiation sensitive. 16. The method of claim 1, further comprising characterizing radiation resistance of the cell by assaying a TP53 DNA binding domain (aa. 101-305) for mutations. 17. The method of claim 1, further comprising characterizing radiation resistance of the cell by detecting a NFE2L2 mutation associated with radiation resistance. 18. A method of treating a subject with non-small cell lung cancer, the method comprising (a) characterizing the radiation-susceptibility of the non-small cell lung cancer by detecting a TP53 or NFE2L2 mutation in the subject; and (b) administering to the subject radiation and a PI3 kinase inhibitor, thereby enhancing the subject's sensitivity to radiation.

Details for Patent 9,439,909

Applicant	Tradename	Biologic Ingredient	Dosage Form	BLA	Approval Date	Patent No.	Expiredate
Merck Sharp & Dohme Corp.	INTRON A	interferon alfa-2b	For Injection	103132	06/04/1986		2033-08-22
Merck Sharp & Dohme Corp.	INTRON A	interferon alfa-2b	For Injection	103132			2033-08-22
Merck Sharp & Dohme Corp.	INTRON A	interferon alfa-2b	Injection	103132			2033-08-22