Claims for Patent: 9,125,930

Summary for Patent: 9,125,930

Title:	EGFR aptamer inhibitor for use in therapy and diagnosis
Abstract:	The present invention concerns a nucleotide aptamer having the sequence 5\' GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3\' (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.
Inventor(s):	De Franciscis; Vittorio (Naples, IT), Cerchia; Laura (Naples, IT)
Assignee:	CONSIGLIO NAZIONALE DELLE RICERCHE (Rome, IT)
Application Number:	13/876,111
Patent Claims:	1. A method for treating an EGFR induced disorder, comprising administering a pharmaceutical composition to a patient in need thereof, the pharmaceutical composition comprising a nucleotide aptamer, wherein the nucleotide aptamer consists of the sequence 5' GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC 3' (SEQ ID NO: 1), and wherein the EGFR induced disorder is a hyperproliferative disorder. 2. The method according to claim 1, wherein the nucleotide aptamer is nuclease-resistant. 3. The method according to claim 1, wherein the pyrimidines of the nucleotide aptamer are 2'-fluoropyrimidine. 4. The method according to claim 1, wherein the EGFR induced hyperproliferative disorder is selected from the group consisting of cancer and primary tumour metastasis. 5. The method according to claim 4 wherein the cancer or primary tumour metastasis is selected from the group consisting of: gastrointestinal cancer, prostate cancer, ovarian cancer, breast cancer, head and neck cancer, lung cancer, non-small cell lung cancer, cancer of the nervous system, kidney cancer, retina cancer, skin cancer, liver cancer, pancreatic cancer, genital-urinary cancer and bladder cancer. 6. The method according to claim 1 wherein the EGFR induced disorder is resistant to treatment with cetuximab and/or gefitinib. 7. The method of claim 1 wherein the pharmaceutical composition consists of the nucleotide aptamer consisting of SEQ ID NO: 1. 8. The method according to claim 1, wherein the pharmaceutical composition further comprises another therapeutic agent. 9. The method according to claim 8, wherein the other therapeutic agent is cetuximab. 10. A method for diagnosing an EGFR induced disorder in a patient, from whom a sample is obtained, comprising: incubating the obtained sample with a nucleotide aptamer; and measuring the binding of the nucleotide aptamer to the sample wherein the nucleotide aptamer consists of the sequence 5' GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC 3' (SEQ ID NO: 1), and wherein the EGFR induced disorder is a hyperproliferative disorder. 11. The method according to claim 10 wherein the sample is a blood, serum or saliva sample, a biopsy, urine or cerebrospinal fluid. 12. A kit for the diagnosis of an EGFR induced disorder in a patient from whom a sample is obtained, the kit comprising a nucleotide aptamer, wherein the nucleotide aptamer consists of the sequence 5' GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC 3' (SEQ ID NO: 1)), and wherein the EGFR induced disorder is a hyperproliferative disorder.

Details for Patent 9,125,930

Applicant	Tradename	Biologic Ingredient	Dosage Form	BLA	Approval Date	Patent No.	Expiredate
Eli Lilly And Company	ERBITUX	cetuximab	Injection	125084	02/12/2004		2030-10-12
Eli Lilly And Company	ERBITUX	cetuximab	Injection	125084	03/28/2007		2030-10-12