Claims for Patent: 7,892,733

Summary for Patent: 7,892,733

Title:	Response element regions
Abstract:	Response element regions, DNA constructs comprising response element regions, host cells comprising response element regions, and methods of using response element regions are provided.
Inventor(s):	Saris; Christiaan J. M. (Newbury Park, CA), Summer; Shamin (Oak Park, CA), Mu; Sharon X. (Thousand Oaks, CA), Crouse; Jill A. (Newbury Park, CA)
Assignee:	Amgen Inc. (Thousand Oaks, CA)
Application Number:	11/112,973
Patent Claims:	1. An isolated nucleic acid comprising a response element region comprising: (i) the sequence GTCATTTCCAGGAAATCACC (SEQ ID NO: 1) or (ii) a sequence complementary to the sequence in (i). 2. An isolated nucleic acid comprising a response element region comprising: (a) (i) the sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA TCACCGTCATTTCCAGGAAATCACC (SEQ ID NO: 2) or (ii) a sequence complementary to the sequence in (i); (b) (i) the sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC (SEQ ID NO: 3) or (ii) a sequence complementary to the sequence in (i); (c) (i) the sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTT CCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATC ACC (SEQ ID NO: 4) or (ii) a sequence complementary to the sequence in (i); or (d) (i) the sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTT CCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATC ACC-Z-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACC (SEQ ID NO: 5) or (ii) a sequence complementary to the sequence in (i); wherein Y, X, and Z are each independently selected from a nucleic acid sequence of 0 to 23 nucleotides. 3. The isolated nucleic acid of claim 2, comprising the sequence: GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-Z-GTCATTTCCAGGAAATCACCGT- CATTTCCAGGAAATCACCGTCATTTCCAGG AAATCACC (SEQ ID NO: 9) wherein Y, X, and Z are each a nucleic acid sequence of 0 nucleotides. 4. The isolated nucleic acid of claim 2, comprising the sequence: GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-Z-GTCATTTCCAGGAAATCACCGT- CATTTCCAGGAAATCACCGTCATTTCCAGG AAATCACC (SEQ ID NO: 10) wherein Y, X, and Z are each a nucleic acid sequence of 8 nucleotides. 5. The isolated nucleic acid of claim 4, wherein Y, X, and Z are each the nucleic acid sequence GCCGTACC. 6. The isolated nucleic acid of claim 2, comprising the sequence: GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-Z-GTCATTTCCAGGAAATCACCGT- CATTTCCAGGAAATCACCGTCATTTCCAGG AAATCACC (SEQ ID NO: 12) wherein Y is a nucleic acid sequence of 8 nucleotides, X is a nucleic acid sequence of 10 nucleotides, and Z is a nucleic acid sequence of 16 nucleotides. 7. The isolated nucleic acid of claim 6, wherein Y is the nucleic acid sequence GCCGTACC, X is the nucleic acid sequence TACCGGTCTG (SEQ ID NO 14), and Z is the nucleic acid sequence ACCGGCCTAGTGCGTC (SEQ ID NO: 15). 8. The isolated nucleic acid of claim 2, comprising the sequence: GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC (SEQ ID NO: 16) wherein Y and X are each a nucleic acid sequence of 0 nucleotides. 9. The isolated nucleic acid of claim 2, comprising the sequence: GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC (SEQ ID NO: 17) wherein Y and X are each a nucleic acid sequence of 8 nucleotides. 10. The isolated nucleic acid of claim 9, wherein Y and X are each the nucleic acid sequence GCCGTACC. 11. The isolated nucleic acid of claim 2, comprising the sequence: GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCGT CATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCGTCATTT CCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTTCCAGG AAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC (SEQ ID NO: 19) wherein Y is a nucleic acid sequence of 8 nucleotides and X is a nucleic acid sequence of 10 nucleotides. 12. The isolated nucleic acid of claim 11, wherein Y is the nucleic acid sequence GCCGTACC and X is the nucleic acid sequence TACCGGTCTG (SEQ ID NO: 14). 13. The isolated nucleic acid of claim 2, wherein Y, X, and/or Z are independently selected from a sequence that is capable of binding to at least one transcription factor selected from NFAT, AP-1, CRE, NF.kappa.B, and a member of the STAT protein family. 14. A response element region comprising more than one response element sequences comprising the sequence GTCATTTCCAGGAAATCACC (SEQ ID NO: 1) wherein the center region of at least two response element sequences are spatially oriented to be in the same location (on the y and z axis) plus or minus 36 degrees, relative to the center axis of the double-helical DNA (x-axis), wherein the center region is the tenth and eleventh nucleotides AG of the sequence GTCATTTCCAGGAAATCACC (SEQ ID NO: 1). 15. A response element region comprising at least two series of more than one response element sequences comprising the sequence GTCATTTCCAGGAAATCACC (SEQ ID NO: 1); wherein each series of more than one response element sequences are linked together by a sequence of approximately eight nucleotides, wherein, within a first series of the response element sequences, each center region of the response element sequences are spatially oriented to be in approximately the same location (on the y and z axis) plus or minus 36 degrees, relative to the center axis of the double-helical DNA (x-axis), wherein the center region is the tenth and eleventh nucleotides AG of the sequence GTCATTTCCAGGAAATCACC (SEQ ID NO: 1); wherein, within a second series of the response element sequences, each center region of the response element sequences are spatially oriented to be in approximately the same location (on the y and z axis) plus or minus 36 degrees, relative to the center axis of the double-helical DNA (x-axis), wherein the center region is the tenth and eleventh nucleotides AG of the sequence GTCATTTCCAGGAAATCACC (SEQ ID NO: 1); and wherein the center region of the response element sequences of the second series of the response element sequences are spatially oriented to be approximately 72 to 86 degrees from the center region of the first series of the response element sequences as determined from the y and z axis relative to the center axis of the double-helical DNA as the x axis. 16. A response element region comprising at least two series of more than one response element sequences comprising the sequence GTCATTTCCAGGAAATCACC (SEQ ID NO: 1); wherein each series of more than one response element sequences are linked together by a sequence of approximately eight nucleotides, wherein, within a first series of the response element sequences, each center region of the response element sequences are spatially oriented to be in approximately the same location (on the y and z axis) plus or minus 36 degrees, relative to the center axis of the double-helical DNA (x-axis), wherein the center region is the tenth and eleventh nucleotides AG of the sequence GTCATTTCCAGGAAATCACC (SEQ ID NO: 1); wherein, within a second series of the response element sequences, each center region of the response element sequences are spatially oriented to be in approximately the same location (on the y and z axis) plus or minus 36 degrees, relative to the center axis of the double-helical DNA (x-axis), wherein the center region is the tenth and eleventh nucleotides AG of the sequence GTCATTTCCAGGAAATCACC (SEQ ID NO: 1); and wherein the center region of the response element sequences of the second series of the response element sequences are spatially oriented to be approximately 144 to 180 degrees from the center region of the first series of the response element sequences as determined from the y and z axis relative to the center axis of the double-helical DNA as the x axis. 17. A vector comprising a promoter and nucleic acid comprising a response element region comprising (i) the sequence GTCATTTCCAGGAAATCACC (SEQ ID NO: 1) or (ii) a sequence complementary to the sequence in (i). 18. A vector comprising a promoter and nucleic acid comprising a response element region comprising: (a) (i) the sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA TCACCGTCATTTCCAGGAAATCACC (SEQ ID NO: 2) or (ii) a sequence complementary to the sequence in (i); (b) (i) the sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC (SEQ ID NO: 3) or (ii) a sequence complementary to the sequence in (i); (c) (i) the sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTT CCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATC ACC (SEQ ID NO: 4) or (ii) a sequence complementary to the sequence in (i); or (d) (i) the sequence GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAA TCACCGTCATTTCCAGGAAATCACC-Y-GTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACC-X-GTCATTT CCAGGAAATCACCGTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATC ACC-Z-GTCATTTCCAGGAAATCACCGTCATTTCCAGGAAATCACCG TCATTTCCAGGAAATCACC (SEQ ID NO: 5) or (ii) a sequence complementary to the sequence in (i); wherein Y, X, and Z are each independently selected from a nucleic acid sequence of 0 to 23 nucleotides. 19. The vector of claim 17 or 18, further comprising a reporter nucleic acid, wherein the response element region is operably linked to the promoter and the promoter is operably linked to the reporter nucleic acid. 20. The vector of claim 19, wherein the promoter is a thymidine kinase (TK) promoter and the reporter nucleic acid is a nucleic acid that encodes luciferase. 21. The vector of claim 19, wherein the promoter is a SV40 promoter and the reporter nucleic acid is a nucleic acid that encodes luciferase. 22. A host cell comprising a vector of claim 19. 23. The host cell of claim 22, wherein host cell is responsive to at least one signaling molecule selected from G-CSF, EPO, and IL-3. 24. The host cell of claim 23, wherein host cell is responsive to at least one signaling molecule selected from recombinant methionyl human granulocyte colony-stimulating factor, epoetin alfa, and darbepoetin alfa. 25. The host cell of claim 22, wherein the host cell is a signaling molecule-responsive host cell. 26. A method for determining the activity of a test composition comprising a signaling molecule, comprising a) contacting the test composition with a signaling molecule-responsive host cell comprising the vector of claim 19 under conditions in which the reporter nucleic acid expresses a reporter protein in response to the signaling molecule; and b) detecting the reporter protein to determine the activity of the test composition. 27. The method of claim 26, wherein the host cell is responsive to at least one signaling molecule selected from G-CSF-like molecule, erythropoietic product, and IL-3. 28. The method of claim 27, wherein the host cell is responsive to at least one signaling molecule selected from recombinant methionyl human granulocyte colony-stimulating factor, epoetin alfa, and darbepoetin alfa. 29. The method of claim 26, wherein the promoter is a TK promoter and the reporter nucleic acid encodes luciferase. 30. The method of claim 26, wherein the promoter is a SV40 promoter and the reporter nucleic acid encodes luciferase. 31. A method for determining the activity of a test composition comprising a signaling molecule, comprising (a) contacting the test composition with a signaling molecule-responsive host cell comprising the vector of claim 19 under conditions in which the reporter nucleic acid expresses a reporter protein in response to the signaling molecule; (b) detecting the reporter protein to determine the activity of the test composition; (c) contacting a signaling molecule-responsive host cell comprising the vector of claim 19 with a blank composition that does not comprise a signaling molecule; (d) detecting the reporter protein to determine the activity of the blank composition; and (e) comparing the level of detected reporter protein expression in (b) with the level of detected reporter protein expression in (d). 32. The method of claim 31, wherein the promoter is a TK promoter and the reporter nucleic acid encodes luciferase. 33. The method of claim 31, wherein the promoter is a SV40 promoter and the reporter nucleic acid encodes luciferase. 34. A method for determining the activity of a test composition comprising a signaling molecule, comprising (a) contacting the test composition with a signaling molecule-responsive host cell comprising the vector of claim 19 under conditions in which the reporter nucleic acid expresses a reporter protein in response to the signaling molecule; (b) detecting the reporter protein to determine the activity of the test composition; (c) contacting a signaling molecule-responsive host cell comprising the vector of claim 19 with a standard composition that comprises a signaling molecule; (d) detecting the reporter protein to determine the activity of the standard composition; and (e) comparing the level of detected reporter protein expression in (b) with the level of detected reporter protein expression in (d). 35. The method of claim 34, wherein the promoter is a TK promoter and the reporter nucleic acid encodes luciferase. 36. The method of claim 34, wherein the promoter is a SV40 promoter and the reporter nucleic acid encodes luciferase. 37. A method of calculating a relative potency of a test composition, comprising (a) contacting the test composition with a signaling molecule-responsive host cell comprising the vector of claim 19 under conditions in which the reporter nucleic acid expresses a reporter protein in response to the signaling molecule; (b) detecting the reporter protein to determine the activity of the test composition; (c) making serial dilutions of a standard composition that comprises a signaling molecule at a known concentration; (d) separately contacting a signaling molecule-responsive host cell comprising the vector of claim 19 with each of the standard test compositions of (c); (e) detecting the reporter protein to determine the activity of each of the serial dilutions of the standard test composition; and (f) calculating the relative potency of the signaling molecule in the test sample by comparing the level of detected reporter protein expression in (b) to the levels of detected reporter protein expression in (e). 38. The method of claim 37, wherein the promoter is a TK promoter and the reporter nucleic acid encodes luciferase. 39. The method of claim 37, wherein the promoter is a SV40 promoter and the reporter nucleic acid encodes luciferase. 40. A method for determining whether a test compound has activity of a given signaling molecule, comprising a) contacting the test compound with a signaling molecule-responsive host cell comprising the vector of claim 19 under conditions in which the reporter nucleic acid expresses a reporter protein in response to compounds that have the activity of the given signaling molecule; b) detecting the reporter protein; c) comparing the level of detected reporter protein expression in (b) with the level of detected reporter protein expressed by a signaling molecule-responsive host cell comprising the vector of claim 19 in the absence of the test compound to determine whether the test compound has the activity of the given signaling molecule. 41. The method of claim 40, wherein the promoter is a TK promoter and the reporter nucleic acid encodes luciferase. 42. The method of claim 40, wherein the promoter is a SV40 promoter and the reporter nucleic acid encodes luciferase. 43. The method of claim 40, wherein the given signaling molecule is selected from G-CSF-like molecule, erythropoietic product, and IL-3. 44. The method of claim 43, wherein the given signaling molecule is selected from recombinant methionyl human granulocyte colony-stimulating factor, epoetin alfa, and darbepoetin alfa. 45. A method for determining whether a test compound has activity of a given signaling molecule, comprising a) contacting the test compound with a signaling molecule-responsive host cell comprising the vector of claim 19 under conditions in which the reporter nucleic acid expresses a reporter protein in response to compounds that have the activity of the given signaling molecule; b) detecting the reporter protein; c) comparing the level of detected reporter protein expression in (b) with the level of detected reporter protein expressed by a signaling molecule-responsive host cell comprising the vector of claim 19 in the presence of the given signaling molecule, but in the absence of the test compound, to determine whether the test compound has the activity of the given signaling molecule. 46. The method of claim 45, wherein the promoter is a TK promoter and the reporter nucleic acid encodes luciferase. 47. The method of claim 45, wherein the promoter is a SV40 promoter and the reporter nucleic acid encodes luciferase. 48. The method of claim 45, wherein the given signaling molecule is selected from G-CSF-like molecule, erythropoietic product, and IL-3. 49. The method of claim 48, wherein the given signaling molecule is selected from recombinant methionyl human granulocyte colony-stimulating factor, epoetin alfa, and darbepoetin alfa. 50. A method for determining whether a test compound impacts the activity of a signaling molecule, comprising a) contacting the test compound with a signaling molecule-responsive host cell comprising the vector of claim 19 in the presence of the signaling molecule under conditions in which the reporter nucleic acid expresses a reporter protein in response to the signaling molecule; b) detecting the reporter protein; c) comparing the level of detected reporter protein expression in (b) with the level of detected reporter protein expressed by a signaling molecule-responsive host cell comprising the vector of claim 19 in the presence of the signaling molecule, but in the absence of the test compound, to determine whether the test compound impacts the activity of the signaling molecule. 51. The method of claim 50, wherein the promoter is a TK promoter and the reporter nucleic acid encodes luciferase. 52. The method of claim 50, wherein the promoter is a SV40 promoter and the reporter nucleic acid encodes luciferase. 53. The method of claim 50, wherein host cell is responsive to at least one signaling molecule selected from G-CSF, EPO, and IL-3. 54. The method of claim 53, wherein host cell is responsive to at least one signaling molecule selected from G-CSF, epoetin alfa, and darbepoetin alfa. 55. A method of producing a polypeptide from an ex vivo mammalian system, comprising producing the polypeptide, testing the polypeptide with the host cell of claim 22, and determining the amount of protein produced and/or activity of the protein produced by the ex vivo system.

Details for Patent 7,892,733

Applicant	Tradename	Biologic Ingredient	Dosage Form	BLA	Approval Date	Patent No.	Expiredate
Amgen, Inc.	EPOGEN/PROCRIT	epoetin alfa	Injection	103234	06/01/1989		2024-04-22
Amgen, Inc.	EPOGEN/PROCRIT	epoetin alfa	Injection	103234			2024-04-22
Amgen, Inc.	PROCRIT	epoetin alfa	Injection	103234			2024-04-22