You’re using a public version of DrugPatentWatch with 5 free searches available | Register to unlock more free searches. CREATE FREE ACCOUNT

Last Updated: March 28, 2024

Claims for Patent: 6,552,181


✉ Email this page to a colleague

« Back to Dashboard


Summary for Patent: 6,552,181
Title: Basal cell carcinoma tumor supressor gene
Abstract:This invention provides for a tumor suppressor gene inactivation of which is a causal factor in nevoid basal cell carcinoma syndrome and various sporadic basal cell carcinomas. The NBCCS gene is a homologue of the Drosophila patched (ptc) gene.
Inventor(s): Dean; Michael Carlton (Frederick, MD), Hahn; Heidi Eve (Washington, DC), Wicking; Carol (Auchenflower, AU), Christiansen; Jeffrey (Yeronga, AU), Zaphiropoulos; Peter G (Tullinge, SE), Gailani; Mae R. (Guilford, CT), Shanley; Susan Mary (Norman Park, AU), Chidambaram; Abirami (Frederick, MD), Vorechovsky; Igor (Huddinge, SE), Holmberg-Lindstrom; Erika (Solna, SE), Unden; Anne Birgitte (Huddinge, SE), Gillies; Susan Alana (Newfarm, AU), Negus; Kylie (Queenslopes, AU), Smyth; Ian Mcleod (Fig Tree Pocket, AU), Pressman; Carol Leah (Houston, TX), Leffell; David J. (New Haven, CT), Gerrard; Bernard (Frederick, MD), Goldstein; Alisa Miriam (Rockville, MD), Wainwright; Brandon (Bardon, AU), Toftgard; Rune Carl-Magnus (Skarholmen, SE), Chenevix-Trench; Georgia (Toowong, AU), Bale; Allen E. (Northford, CT)
Assignee: The United States of America as represented by the Department of Health and Human Services (Washington, DC)
Application Number:08/857,636
Patent Claims:1. An isolated nucleic acid encoding a human nevoid basal cell carcinoma syndrome (NBCCS) (PTC) protein, wherein said protein has a sequence consisting of SEQ. ID. NO:60.

2. The nucleic acid of claim 1, wherein the nucleic acid further comprises a recombinant vector.

3. An isolated nucleic acid wherein said nucleic acid has one missense, nonsense, or frameshift mutation compared to SEQ ID NO:1.

4. The nucleic acid of claim 3, wherein the mutation or mutations is selected from the group consisting of Exon 5 693 insC, Exon 17 2988 del8bp, Exon 17 3014 insA, Exon 21 3538 delG, Exon 22 G4302T, Exon 12 1711insC, Exon 12 1639insA, Exon 16 2707delC, and Intron 17 3157-2A.fwdarw.G.

5. The nucleic acid of claim 3, wherein the mutation is a nonsense mutation.

6. The nucleic acid of claim 3, wherein the mutation is a frameshift mutation.

7. The nucleic acid of claim 6, wherein the mutation is selected from the group consisting of 244delCT, 271insA, 464insAC, 693insC, 804del37, 877delG, 929delC, 1370del76, 1393insTGCC, 1639insA, 1711insC, 2000insC, 2047insCT, 2183delTC, 2320insA, 2392delA, 2583delC, del 2704-2717, 2707delC, 2748insC, 2988del8bp, 3014insA, 3352delAT, and 3538delG.

8. The nucleic acid of claim 3, wherein the mutation is a missense mutation.

9. The nucleic acid of claim 8, wherein the mutation is selected from the group consisting of G1148A, G1368A, G1525T, C2068T, C3015A, G3193C, and G4302T.

10. The nucleic acid of claim 6, wherein the mutation alters mRNA splicing of an exon selected from the group consisting of 1, 1a, and 2a.

11. The nucleic acid of claim 3, wherein the mutation is selected from the group consisting of A1055-2C, and 3157-2A.fwdarw.G.

12. The nucleic acid of claim 3, wherein the mutation is selected from C391T, C1081T, G1148A, CC1081TT, 1444del6, and C2050T.

13. An isolated nucleic acid encoding at least 10 contiguous amino acid residues of a portion of a human nevoid basal cell carcinoma syndrome (NBCCS)(PTC) protein, which nucleic acid encoding said portion of said protein is selected from the group consisting of (a) a portion of SEQ ID NO:1 amplified from a human genomic library by primers SEQ ID NO:10 and 11, (b) a portion of SEQ ID NO:1 amplified from a human genomic library by primers SEQ ID NO:12 and 13, and (c) the sequence GGAGGACGAGGAAAGGGGGGCCAGGGAAAAAAATTGATGTGAAATCCAAGCCCGCGCTCCGAGCAGGGGTTGAC GGCCGGCTATG (exon 2a, SEQ ID NO: 84), and (d) a nucleic acid that differs from a portion of SEQ ID NO: 1 amplified by the primers of (a) or (b) or encoded by the sequence of (c) by encoding a protein with a conservative substitution of an amino acid relative to the sequence encoded by SEQ ID NO: 1.

14. The nucleic acid of claim 13, wherein said portion of said protein is encoded by a nucleic acid selected from the group consisting of a nucleic acid sequence amplified by primers SEQ ID NO:10 and 11, a nucleic acid sequence amplified by primers SEQ ID NO:12 and 13, and a nucleic acid sequence GGAGGACGAGGAAAGGGGGGCCAGGGAAAAAAATTGATGTGAAATCCAAGCCCGCGCTCCGAGCAGGGGTTGAC GGCCGGCTATG (exon 2a, SEQ ID NO: 84).

15. A recombinant vector comprising a nucleic acid of claim 13.

16. An isolated nucleic acid encoding a human nevoid basal cell carcinoma (NBCCS) (PTC) polypeptide comprising at least 10 contiguous amino acids from a polypeptide sequence encoded by a nucleic acid selected from the group consisting of (a) a nucleic acid sequence amplified from a human genomic library by primers SEQ ID NO:10 and 11, (b) a nucleic acid sequence amplified from a human genomic library by primers SEQ ID NO:12 and 13, and (c) a nucleic acid sequence GGAGGACGAGGAAAGGGGGGCCAGGGAAAAAAATTGATGTGAAATCCAAGCCCGCGCTCCGAGCACGGGTTGAC GGCCGGCTATG (exon 2a, SEQ ID NO: 84), wherein: said polypeptide, when presented as an antigen, elicits the production of an antibody which specifically binds to a human nevoid basal cell carcinoma (NBCCS) (PTC) polypeptide encoded by SEQ ID NO:1.

17. A recombinant vector comprising a nucleic acid of claim 16.

18. An isolated nucleic acid, which nucleic acid encodes a human nevoid basal cell carcinoma (NBCCS) (PTC) polypeptide comprising at least 10 contiguous amino acids from a polypeptide sequence encoded by a nucleic acid selected from the group consisting of (a) a nucleic acid sequence amplified from a human genomic library by primers SEQ ID NO:10 and 11, (b) a nucleic acid sequence amplified from a human genomic library by primers SEQ ID NO:12 and 13, and (c) a nucleic acid sequence GGAGGACGAGGAAAGGGGGGCCAGGGAAAAAAATTGATGTGAAATCCAAGCCCGCGCTCCGAGCAGGGGTTGAC GGCCGGCTATG (exon 2a, SEQ ID NO: 84).

19. An isolated nucleic acid encoding a human nevoid basal cell carcinoma syndrome (NBCCS) (PTC) protein, wherein said nucleic acid has the sequence of SEQ ID NO:1.

20. An isolated nucleic acid having a coding region encoding a polypeptide, which coding region has at least 98% sequence identity to a nucleic acid sequence of nucleotides 442 to 4329 of SEQ ID NO:1.

21. A recombinant vector comprising the nucleic acid of claim 20.

Details for Patent 6,552,181

Applicant Tradename Biologic Ingredient Dosage Form BLA Approval Date Patent No. Expiredate
Merck Sharp & Dohme Corp. INTRON A interferon alfa-2b For Injection 103132 06/04/1986 ⤷  Try a Trial 2016-05-17
Merck Sharp & Dohme Corp. INTRON A interferon alfa-2b For Injection 103132 ⤷  Try a Trial 2016-05-17
Merck Sharp & Dohme Corp. INTRON A interferon alfa-2b Injection 103132 ⤷  Try a Trial 2016-05-17
>Applicant >Tradename >Biologic Ingredient >Dosage Form >BLA >Approval Date >Patent No. >Expiredate

Make Better Decisions: Try a trial or see plans & pricing

Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. thinkBiotech performs no independent verification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.