You’re using a public version of DrugPatentWatch with 5 free searches available | Register to unlock more free searches. CREATE FREE ACCOUNT

Last Updated: April 23, 2024

Claims for Patent: 4,963,665

✉ Email this page to a colleague

« Back to Dashboard

Summary for Patent: 4,963,665

Title:	Human preproinsulin-like growth factor I
Abstract:	The invention provides DNA sequences encoding a human preproinsulin-like growth factor I protein and novel extension peptides. A novel preproinsulin-like growth factor I protein and novel extension peptides are also provided. The present invention further provides a human IGF-I gene which has been sequenced and which encodes at least two preproinsulin-like growth factor-I proteins. Various genes and DNA sequences useful in producing essentially pure mature IGF-I, preproinsulin-like growth factor I proteins and IGF-I gene related proteins are also provided.
Inventor(s):	Rotwein; Peter S. (St. Louis, MO), Krivi; Gwen G. (Olivette, MO)
Assignee:	Washington University (St. Louis, MO)
Application Number:	06/929,671
Patent Claims:	1. A synthetic DNA sequence encoding a preproinsulin-like growth factor-I protein comprising the sequence of amino acids shown in FIG. 2. 2. A synthetic DNA sequence comprising the sequence of nucleotides from about nucleotide 1 to about nucleotide 1136 shown in FIG. 2. 3. A synthetic DNA sequence comprising the sequence of nucleotides from about nucleotide 183 to about nucleotide 767 shown in FIG. 2. 4. A synthetic DNA sequence encoding a mature human IGF-I peptide linked directly at its carboxy-end to the amino terminus of a peptide comprising the following sequence of amino acids: NH.sub.2 --Arg Ser Val Arg Ala Gln Arg His Thr Asp Met Pro Lys Thr Gln Lys Tyr Gln Pro Pro Ser Thr Asn Lys Asn Thr Lys Ser Gln Arg Arg Lys Gly Trp Pro Lys Thr His Pro Gly Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Leu Gln Ile Arg Gly Lys Lys Lys Glu Gln Arg Arg Glu Ile Gly Ser Arg Asn Ala Glu Cys Arg Gly Lys Lys Gly Lys--COOH. 5. A DNA sequence of claim 4 comprising the sequence of nucleotides from about nucleotide 327 to about nucleotide 767 shown in FIG. 2. 6. A synthetic DNA sequence encoding a peptide comprising of the following sequence of amino acids: NH.sub.2 --Arg Ser Val Arg Ala Gln Arg His Thr Asp Met Pro Lys Thr Gln Lys Tyr Gln Pro Pro Ser Thr Asn Lys Asn Thr Lys Ser Gln Arg Arg Lys Gly Trp Pro Lys Thr His Pro Gly Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Leu Gln Ile Arg Gly Lys Lys Lys Glu Gln Arg Arg Glu Ile Gly Ser Arg Asn Ala Glu Cys Arg Gly Lys Lys Gly Lys--COOH. 7. A DNA sequence of claim 6 comprising the sequence of nucleotides from about nucleotide 537 to about nucleotide 767 shown in FIG. 2. 8. A synthetic DNA sequence encoding a peptide comprising of the following sequence of amino acids: NH.sub.2 --Tyr Gln Pro Pro Ser Thr Asn Lys Asn Thr Lys Ser Gln Arg Arg Lys Gly Trp Pro Lys Thr His Pro Gly Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Leu Gln Ile Arg Gly Lys Lys Lys Glu Gln Arg Arg Glu Ile Gly Ser Arg Asn Ala Glu Cys Arg Gly Lys Lys Gly Lys--COOH. 9. A DNA sequence of claim 8 comprising the following sequence of nucleotides: 5'--TATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGG AGGGGAACAGAAGGAGGGGACAGAAGCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGG AAGTAGAATGCTGAATGCLAGAGGCAAAAAAGGAAAATGA--3 '. 10. An essentially intron-free DNA sequence encoding a preproinsulin-like growth factor-I comprising the sequence of amino acids shown in FIG. 6. 11. An essentially intron-free DNA sequence encoding a mature human insulin-like growth factor-I peptide linked directly at its carboxy-end to the amino-terminus of a peptide comprising the following sequence of amino acids: NH.sub.2 --Arg Ser Val Arg Ala Gln Arg His Thr Asp Met Pro Lys Thr Gln Lys Tyr Gln Pro Pro Ser Thr Asn Lys Asn Thr Lys Ser Gln Arg Arg Lys Gly Trp Pro Lys Thr His Pro Gly Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Leu Gln Ile Arg Gly Lys Lys Lys Glu Gln Arg Arg Glu Ile Gly Ser Arg Asn Ala Glu Cys Arg Gly Lys Lys Gly Lys--COOH. 12. An essentially intron-free DNA sequence encoding extension peptide comprising the following sequence of amino acids: NH.sub.2 --Arg Ser Val Arg Ala Gln Arg His Thr Asp Met Pro Lys Thr Gln Lys Tyr Gln Pro Pro Ser Thr Asn Lys Asn Thr Lys Ser Gln Arg Arg Lys Gly Trp Pro Lys Thr His Pro Gly Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Leu Gln Ile Arg Gly Lys Lys Lys Glu Gln Arg Arg Glu Ile Gly Ser Arg Asn Ala Glu Cys Arg Gly Lys Lys Gly Lys--COOH. 13. An essentially intron-free DNA sequence encoding a extension peptide comprising the following sequence of amino acids: NH.sub.2 --Tyr Gln Pro Pro Ser Thr Asn Lys Asn Thr Lys Ser Gln Arg Arg Lys Gly Trp Pro Lys Thr His Pro Gly Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Leu Gln Ile Arg Gly Lys Lys Lys Glu Gln Arg Arg Glu Ile Gly Ser Arg Asn Ala Glu Cys Arg Gly Lys Lys Gly Lys--COOH. 14. A recombinant DNA vector containing a DNA sequence encoding a preproinsulin-like growth factor I protein comprising the sequence of amino acids shown in FIG. 6. 15. An essentially pure DNA molecule comprising the sequence of nucleotides in the IGF-I gene exon 4 shown in FIG. 4. 16. A recombinant DNA vector containing a DNA sequence encoding an essentially pure mature human insulin-like growth factor-I peptide linked directly at its carboxy-end to the amino-terminus of a peptide comprising the following sequence of amino acids: NH.sub.2 --Arg Ser Val Arg Ala Gln Arg His Thr Asp Met Pro Lys Thr Gln Lys Tyr Gln Pro Pro Ser Thr Asn Lys Asn Thr Lys Ser Gln Arg Arg Lys Gly Trp Pro Lys Thr His Pro Gly Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Leu Gln Ile Arg Gly Lys Lys Lys Glu Gln Arg Arg Glu Ile Gly Ser Arg Asn Ala Glu Cys Arg Gly Lys Lys Gly Lys--COOH. 17. A recombinant DNA vector containing a intron-free DNA sequence encoding an extension peptide comprising the following sequence of amino acids: NH.sub.2 --Arg Ser Val Arg Ala Gln Arg His Thr Asp Met Pro Lys Thr Gln Lys Tyr Gln Pro Pro Ser Thr Asn Lys Asn Thr Lys Ser Gln Arg Arg Lys Gly Trp Pro Lys Thr His Pro Gly Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Leu Gln Ile Arg Gly Lys Lys Lys Glu Gln Arg Arg Glu Ile Gly Ser Arg Asn Ala Glu Cys Arg Gly Lys Lys Gly Lys--COOH. 18. A recombinant DNA vector containing a intron-free DNA sequence encoding an extension peptide comprising the following sequence of amino acids: NH.sub.2 --Tyr Gln Pro Pro Ser Thr Asn Lys Asn Thr Lys Ser Gln Arg Arg Lys Gly Trp Pro Lys Thr His Pro Gly Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Leu Gln Ile Arg Gly Lys Lys Lys Glu Gln Arg Arg Glu Ile Gly Ser Arg Asn Ala Glu Cys Arg Gly Lys Lys Gly Lys--COOH.

Details for Patent 4,963,665

Subscribe to access the full database, or Try a Trial
Applicant	Tradename	Biologic Ingredient	Dosage Form	BLA	Approval Date	Patent No.	Expiredate
Merck Sharp & Dohme Corp.	INTRON A	interferon alfa-2b	For Injection	103132	06/04/1986	⤷ Try a Trial	2007-10-16
Merck Sharp & Dohme Corp.	INTRON A	interferon alfa-2b	For Injection	103132		⤷ Try a Trial	2007-10-16
Merck Sharp & Dohme Corp.	INTRON A	interferon alfa-2b	Injection	103132		⤷ Try a Trial	2007-10-16
>Applicant	>Tradename	>Biologic Ingredient	>Dosage Form	>BLA	>Approval Date	>Patent No.	>Expiredate

Make Better Decisions: Try a trial or see plans & pricing

Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. thinkBiotech performs no independent verification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.