You’re using a public version of DrugPatentWatch with 5 free searches available | Register to unlock more free searches. CREATE FREE ACCOUNT

Last Updated: March 28, 2024

Claims for Patent: 10,400,289


✉ Email this page to a colleague

« Back to Dashboard


Summary for Patent: 10,400,289
Title:Polynucleotide probe, method for detecting a target nucleic acid by using the same and kit comprising the same
Abstract: The present invention provides a method for detecting a target nucleic acid that comprises a step of providing a sample; contacting the sample with a polynucleotide probe comprising a first sequence and a second sequence complementary to the target nucleic acid; and adding a nuclease for cleaving the second sequence of the polynucleotide probe. The present invention further provides a polynucleotide probe for detecting a target nucleic acid that comprises a first sequence and a second sequence complementary to the target nucleic acid. Moreover, the present invention provides a kit for detecting a target nucleic acid.
Inventor(s): Ho; Ja-An A. (Taipei, TW), Jou; Amily F. (Taipei, TW), Ou; Yen-Chuan (Taipei, TW), Wang; Shian-Shiang (Taipei, TW), Willner; Itamar (Taipei, TW), Hsu; Shih-Lan (Taipei, TW)
Assignee: National Taiwan University (Taipei, TW)
Application Number:15/870,336
Patent Claims:1. A method for detecting a target nucleic acid, comprising: providing a sample; contacting the sample with an artificially synthesized polynucleotide probe, wherein the artificially synthesized polynucleotide probe comprises a polynucleotide connected to a support and an acceptor at two ends of the polynucleotide, respectively, and wherein the support has an optical property and transfers energy to the acceptor to trigger a luminescence change, and the polynucleotide comprises: a first sequence; and a second sequence complementary to the target nucleic acid, wherein the first sequence is a telomerase primer that is at least three continuous nucleotides complementary to a sequence of any one of SEQ ID NOs. 1-5; adding a duplex-specific nuclease for cleaving a duplex formed by the second sequence of the artificially synthesized polynucleotide probe and the target nucleic acid to generate a first signal; adding a telomerase to extend the first sequence; adding a reporter compound to form a complex with the extended first sequence and generate a second signal; and detecting the second signal generated from the complex as indicative of the presence of the target nucleic acid.

2. The method according to claim 1, wherein the telomerase primer is at least three continuous nucleotides complementary to a sequence of SEQ ID NO. 1.

3. The method according to claim 1, wherein the second sequence is CCATCTTTACCAGACAGTGTTA (SEQ ID NO. 20).

4. The method according to claim 1, wherein the support is a nanoparticle or a bead.

5. The method according to claim 4, wherein the nanoparticle comprises one selected from the group consisting of a core-type quantum dot, a core-shell quantum dot, an alloyed quantum dot and a combination thereof.

6. The method according to claim 5, wherein the nanoparticle is a CdSe/ZnS quantum dot.

7. The method according to claim 1, wherein the acceptor is a luminescent dye or a quencher.

8. The method according to claim 1, wherein the acceptor is BHQ2 or Cy5.

9. The method according to claim 1, wherein the extended first sequence comprises any one of SEQ ID NOs. 6-19.

10. The method according to claim 1, wherein the compound is a signal-generating molecule or hemin.

11. The method according to claim 1, wherein the complex is a signal-generating structure or a telomeric hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme.

Make Better Decisions: Try a trial or see plans & pricing

Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. thinkBiotech performs no independent verification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.