Claims for Patent: 10,336,829

Summary for Patent: 10,336,829

Title:	Intracellular delivery compounds
Abstract:	Provided are compounds having the Formula I: ##STR00001## pharmaceutically acceptable salts thereof, pharmaceutical compositions thereof, and their use in the intracellular delivery of antibodies.
Inventor(s):	Fu; Yanwen (San Diego, CA), Kaufmann; Gunnar Jorg Floris (San Diego, CA), Lee; Heehyoung (Arcadia, CA), Lalaso; Ingale Sampat (San Diego, CA)
Assignee:	Sorrento Therapeutics, Inc. (San Diego, CA)
Application Number:	15/298,813
Patent Litigation and PTAB cases:	See patent lawsuits and PTAB cases for patent 10,336,829
Patent Claims:	1. A compound having the Formula I: ##STR00049## wherein, each Ba is independently selected from adenine (A), guanine (G), cytosine (C), and thymine (T); X is O or S; each R.sub.1 is independently selected from hydrogen and (C.sub.1-C.sub.6)alkyl substituted with a fluorophore; q is an integer from 12 to 35; r is an integer from 1 to 10; t is an integer from 1 to 10; L is --CH.sub.2--R.sup.2--*; R.sup.2 is --(C.sub.1-C.sub.6)alkyl substituted with 1 or 2 groups selected from --C(.dbd.O)NR.sup.a, --NR.sup.aC(.dbd.O)R.sup.b, --NR.sup.aC(.dbd.O)R.sup.d, .dbd.NOR.sup.e, --NR.sup.a, --NR.sup.aR.sup.b, --OR.sup.b, --S(O).sub.kR.sup.b, --NR.sup.aS(O).sub.2R.sup.b, --S(O).sub.2NR.sup.aR.sup.b, --S(O).sub.2NR.sup.a, --C(.dbd.O)OR.sup.b, --OC(.dbd.O)OR.sup.b, --OC(.dbd.O)R.sup.b, --C(.dbd.O)NR.sup.aR.sup.b, --NR.sup.aC(.dbd.O)R.sup.b, --NR.sup.aC(.dbd.O)OR.sup.b, --OC(.dbd.O)NR.sup.aR.sup.b, phenyl, --OC(.dbd.O)NR.sup.a, --NR.sup.aC(.dbd.O)NR.sup.aR.sup.b, --NR.sup.aC(.dbd.O)NR.sup.a, --NR.sup.a(C.dbd.S)NR.sup.aR.sup.b, --NR.sup.a(C.dbd.S)NR.sup.a, and --C(.dbd.O)R.sup.b; k is 0, 1, or 2; each R.sup.a is independently hydrogen or (C.sub.1-C.sub.6)alkyl optionally substituted with R.sup.f; each R.sup.b is independently (C.sub.1-C.sub.6)alkyl optionally substituted with R.sup.f or --C(.dbd.O)R.sup.f; R.sup.d is --[(C.sub.1-C.sub.6)alkyl-O--(C.sub.1-C.sub.6)alkyl].sub.vC(.dbd.O)NH; R.sup.e is --[(C.sub.1-C.sub.6)alkyl-O--(C.sub.1-C.sub.6)alkyl].sub.pC(.dbd.O); each R.sup.f is independently ##STR00050## wherein the wavy bond indicates the point of attachment to the (C.sub.1-C.sub.6)alkyl defined by R.sup.a, or the (C.sub.1-C.sub.6)alkyl or carbonyl each defined by R.sup.b; R.sup.g is (C.sub.1-C.sub.6)alkyl or --[(C.sub.1-C.sub.6)alkyl-O--(C.sub.1-C.sub.6)alkyl].sub.wC(.dbd.O)NH; ring A is ##STR00051## wherein the dashed bonds indicate the points of attachment to the triazolyl of R.sup.f, and the wavy bond indicates the point of attachment to the (C.sub.1-C.sub.6)alkyl defined by R.sup.a, or the (C.sub.1-C.sub.6)alkyl or carbonyl each defined by R.sup.b; p is an integer from 1 to 10; v is an integer from 1 to 10; w is an integer from 2 to 12; * indicates the point of attachment to A.sub.T; and A.sub.T is an antibody. 2. The compound of claim 1, wherein R.sup.2 is --(C.sub.1-C.sub.6)alkyl substituted with --C(.dbd.O)NR.sup.a, --NR.sup.aC(.dbd.O)R.sup.b, --NR.sup.aC(.dbd.O)R.sup.d, .dbd.NOR.sup.e, --NR.sup.a, --NR.sup.aR.sup.b, --OR.sup.b, --S(O).sub.kR.sup.b, --NR.sup.aS(O).sub.2R.sup.b, --S(O).sub.2NR.sup.aR.sup.b, --S(O).sub.2NR.sup.a, --C(.dbd.O)OR.sup.b, --OC(.dbd.O)OR.sup.b, --OC(.dbd.O)R.sup.b, --C(.dbd.O)NR.sup.aR.sup.b, --NR.sup.aC(.dbd.O)R.sup.b, --NR.sup.aC(.dbd.O)OR.sup.b, --OC(.dbd.O)NR.sup.aR.sup.b, --OC(.dbd.O)NR.sup.a, --NR.sup.aC(.dbd.O)NR.sup.aR.sup.b, --NR.sup.aC(.dbd.O)NR.sup.a, --NR.sup.a(C.dbd.S)NR.sup.aR.sup.b, --NR.sup.a(C.dbd.S)NR.sup.a, or --C(.dbd.O)R.sup.b. 3. The compound of claim 1, wherein R.sup.2 is --(C.sub.1-C.sub.6)alkyl substituted with --C(.dbd.O)NR.sup.a, --NR.sup.aC(.dbd.O)R.sup.b, --NR.sup.aC(.dbd.O)R.sup.d, .dbd.NOR.sup.e, --NR.sup.a, --R.sup.aR.sup.b, --OR.sup.b, --S(O).sub.2NR.sup.aR.sup.b, --S(O).sub.2NR.sup.a, --C(.dbd.O)OR.sup.b, --C(.dbd.O)NR.sup.aR.sup.b, --NR.sup.aC(.dbd.O)R.sup.b, --NR.sup.aC(.dbd.O)OR.sup.b, --NR.sup.aC(.dbd.O)NR.sup.aR.sup.b, --NR.sup.aC(.dbd.O)NR.sup.a, or --C(.dbd.O)R.sup.b. 4. The compound of claim 1, wherein R.sub.2 is --(C.sub.1-C.sub.6)alkyl-NR.sup.aC(.dbd.O)R.sup.d, --(C.sub.1-C.sub.6)alkyl-NR.sup.aC(.dbd.O)R.sup.b, or --(C.sub.1-C.sub.6)alkyl(=NO)R.sup.e. 5. The compound of claim 1, wherein R.sup.d is --[(C.sub.1-C.sub.4)alkyl-O--(C.sub.1-C.sub.4)alkyl].sub.vC(.dbd.O)NH. 6. The compound of claim 1, wherein R.sup.e is --[(C.sub.1-C.sub.4)alkyl-O--(C.sub.1-C.sub.4)alkyl].sub.pC(.dbd.O). 7. The compound of claim 1, wherein R.sup.g is --[(C.sub.1-C.sub.4)alkyl-O--(C.sub.1-C.sub.4)alkyl].sub.vC(.dbd.O)NH. 8. The compound of claim 1, wherein each R.sup.a is independently selected from hydrogen and (C.sub.1-C.sub.6)alkyl. 9. The compound of claim 1, wherein R.sup.b is (C.sub.1-C.sub.6)alkyl substituted with R.sup.f or --C(.dbd.O)R.sup.f. 10. The compound of claim 1, wherein p is an integer from 1 to 6. 11. The compound of claim 1, wherein v is an integer from 1 to 6. 12. The compound of claim 1, wherein w is an integer from 2 to 8. 13. The compound of claim 1, wherein R.sup.f is ##STR00052## 14. The compound of claim 1, wherein ring A is ##STR00053## 15. The compound of claim 1, wherein the fluorophore, if present, is fluorescein. 16. The compound of claim 1, wherein the compound is of the Formula IIb: ##STR00054## or a pharmaceutically acceptable salt thereof. 17. The compound of claim 1, wherein the compound is of the Formula IIIa: ##STR00055## or a pharmaceutically acceptable salt thereof. 18. The compound of any one of claims 1 to 10, wherein the compound is of the Formula IVa: ##STR00056## or a pharmaceutically acceptable salt thereof. 19. The compound of claim 1, wherein X is S. 20. The compound of claim 1, wherein r is an integer from 3 to 5. 21. The compound of claim 1, wherein t is an integer from 2 to 4. 22. The compound of claim 1, wherein q is an integer from 15 to 25. 23. The compound of claim 1, wherein the thiophosphate oligonucleotide sequence beginning at the 3' end is TCCATGAGCTTCCTGATGCT (SEQ ID NO.: 5). 24. The compound of claim 1, wherein A.sub.T is an IgG antibody. 25. The compound of claim 1, wherein A.sub.T is anti-STAT3, panitumumab, CTLA4, or VEGFR2. 26. The compound of claim 1, wherein the compound is ##STR00057## ##STR00058## ##STR00059## ##STR00060## ##STR00061## ##STR00062## ##STR00063## or a pharmaceutically acceptable salt thereof ("TCCATGAGCTTCCTGATGCT" disclosed as SEQ ID NO.: 5). 27. A pharmaceutical composition comprising the compound of claim 1, or a pharmaceutically acceptable salt thereof; and a pharmaceutically acceptable carrier. 28. A method of treating a disease or disorder selected from autoimmune disease, developmental disorder, inflammatory disease, metabolic disorder, cardiovascular disease, liver disease, intestinal disease, infectious disease, endocrine disease, neurological disorder, and cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of claim 1, or a pharmaceutically acceptable salt thereof. 29. A process for producing a compound having the Formula I: ##STR00064## wherein, each Ba is independently selected from adenine (A), guanine (G), cytosine (C), and thymine (T); X is O or S; each R.sub.1 is independently selected from hydrogen and (C.sub.1-C.sub.6)alkyl substituted with a fluorophore; q is an integer from 12 to 35; r is an integer from 1 to 10; t is an integer from 1 to 10; L is --CH.sub.2--R.sup.2--*; R.sup.2 is --(C.sub.1-C.sub.6)alkyl-NR.sup.aC(.dbd.O)R.sup.b; R.sup.a is hydrogen or (C.sub.1-C.sub.6)alkyl; R.sup.b is (C.sub.1-C.sub.6)alkyl substituted with R.sup.f or --C(.dbd.O)R.sup.f; R.sup.f is ##STR00065## ring A is ##STR00066## wherein the dashed bonds indicate the points of attachment to the triazolyl of R.sup.f and the wavy bond indicates the point of attachment to the (C.sub.1-C.sub.6)alkyl or carbonyl each defined by R.sup.b; and R.sup.g is (C.sub.1-C.sub.6)alkyl or --[(C.sub.1-C.sub.6)alkyl-O--(C.sub.1-C.sub.6)alkyl].sub.wC(.dbd.O)NH; w is an integer from 2 to 12; * indicates the point of attachment to A.sub.T; and A.sub.T is an antibody; the process comprising reacting a compound having the Formula 100: ##STR00067## wherein X.sup.2 is --CH.sub.2(C.sub.1-C.sub.6)alkyl-NR.sup.aC(.dbd.O)R.sup.b; R.sup.a is hydrogen or (C.sub.1-C.sub.6)alkyl; R.sup.b is (C.sub.1-C.sub.6)alkyl substituted with R.sup.40 or --C(.dbd.O)R.sup.40; and R.sup.40 is ##STR00068## wherein the wavy line indicates the point of attachment to the (C.sub.1-C.sub.6)alkyl or carbonyl defined by R.sup.b; with a compound having the Formula A.sub.T-Y, wherein Y is --R.sup.gN.sub.3.

Details for Patent 10,336,829

Applicant	Tradename	Biologic Ingredient	Dosage Form	BLA	Approval Date	Patent No.	Expiredate
Amgen, Inc.	VECTIBIX	panitumumab	Injection	125147	09/27/2006		2035-10-20